pBR322 Plasmid


  • Model: PVT0009
  • 50 Units in Stock
Ask a question

Add to Cart:


PVT0009  2ug


pBR322 Informaiton

Replicon: PBR322 ori

Plasmid classification: large intestine series plasmid; large intestine clone plasmid; gene clone plasmid.

Plasmid size: 4361bp

Prokaryotic resistance: ampicillin Amp (100 g/ml), tetracycline Tet (10 g/ml)

Cloning strains: E. coli DH5 and E.

Culture conditions: 37 C, aerobic, LB

5'sequencing primers: PBR322.F (AAGTGCCACCTGACGTCTAA)

3'sequencing primers: PBR322.R (GCCTGCCACCATACCCAC)


pBR322 Description

The pBR322 plasmid has a small relative molecular weight and has a replication initiation site, which ensures that the plasmid can only replicate in E. coli cells. There are two antibiotic resistance genes, ampicillin resistance gene and tetracycline resistance gene, which can be used as selective markers for transformants. With high copy number, each cell can accumulate 1000-3000 copies after chloramphenicol amplification, which provides great convenience for the preparation of recombinant DNA. At the same time, because of its artificial construction of plasmids, although with resistance genes, but can not transfer between natural host cells, and the use of safe strains, will not cause antibiotic resistance gene transmission.

PBR322 is an important plasmid constructed artificially and has universal plasmid. It was constructed by a complex recombination process of pSF2124, pMB1 and pSC101 three parental plasmids.

The size of plasmid vector pBR322 is 4361bp, and its relative molecular weight is the first advantage. The second advantage is that it carries a replication initiation site, which ensures that the plasmid can only replicate in E. coli cells. It has two antibiotic resistance genes, ampicillin resistance gene and tetracycline resistance gene. Selective markers for transformants are its third advantage.


pBR322 Multiple cloning site




pBR322 Sequence

LOCUS       Exported                4361 bp ds-DNA    circular SYN 22-9-2015
KEYWORDS    Untitled
SOURCE      synthetic DNA construct
  ORGANISM  synthetic DNA construct
REFERENCE   1  (bases 1 to 4361)
  AUTHORS   admin
  TITLE     Direct Submission
  JOURNAL   Exported 2015-9-22  
FEATURES             Location/Qualifiers
     source          1..4361
                     /organism="synthetic DNA construct"
                     /mol_type="other DNA"
     promoter        10..38
                     /note="tet promoter"
                     /note="E. coli promoter for tetracycline efflux protein
     CDS             86..1276
                     /product="tetracycline efflux protein"
                     /note="confers resistance to tetracycline"
     CDS             1915..2106
                     /product="Rop protein, which maintains plasmids at low copy
     misc_feature    2208..2348
                     /note="basis of mobility region from pBR322"
     rep_origin      complement(2534..3122)
                     /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of
     CDS             complement(3293..4153)
                     /note="confers resistance to ampicillin, carbenicillin, and
                     related antibiotics"
     promoter        complement(4154..4258)
                     /note="AmpR promoter"
        1 ttctcatgtt tgacagctta tcatcgataa gctttaatgc ggtagtttat cacagttaaa
       61 ttgctaacgc agtcaggcac cgtgtatgaa atctaacaat gcgctcatcg tcatcctcgg
      121 caccgtcacc ctggatgctg taggcatagg cttggttatg ccggtactgc cgggcctctt
      181 gcgggatatc gtccattccg acagcatcgc cagtcactat ggcgtgctgc tagcgctata
      241 tgcgttgatg caatttctat gcgcacccgt tctcggagca ctgtccgacc gctttggccg
      301 ccgcccagtc ctgctcgctt cgctacttgg agccactatc gactacgcga tcatggcgac
      361 cacacccgtc ctgtggatcc tctacgccgg acgcatcgtg gccggcatca ccggcgccac
      421 aggtgcggtt gctggcgcct atatcgccga catcaccgat ggggaagatc gggctcgcca
      481 cttcgggctc atgagcgctt gtttcggcgt gggtatggtg gcaggccccg tggccggggg
      541 actgttgggc gccatctcct tgcatgcacc attccttgcg gcggcggtgc tcaacggcct
      601 caacctacta ctgggctgct tcctaatgca ggagtcgcat aagggagagc gtcgaccgat
      661 gcccttgaga gccttcaacc cagtcagctc cttccggtgg gcgcggggca tgactatcgt
      721 cgccgcactt atgactgtct tctttatcat gcaactcgta ggacaggtgc cggcagcgct
      781 ctgggtcatt ttcggcgagg accgctttcg ctggagcgcg acgatgatcg gcctgtcgct
      841 tgcggtattc ggaatcttgc acgccctcgc tcaagccttc gtcactggtc ccgccaccaa
      901 acgtttcggc gagaagcagg ccattatcgc cggcatggcg gccgacgcgc tgggctacgt
      961 cttgctggcg ttcgcgacgc gaggctggat ggccttcccc attatgattc ttctcgcttc
     1021 cggcggcatc gggatgcccg cgttgcaggc catgctgtcc aggcaggtag atgacgacca
     1081 tcagggacag cttcaaggat cgctcgcggc tcttaccagc ctaacttcga tcactggacc
     1141 gctgatcgtc acggcgattt atgccgcctc ggcgagcaca tggaacgggt tggcatggat
     1201 tgtaggcgcc gccctatacc ttgtctgcct ccccgcgttg cgtcgcggtg catggagccg
     1261 ggccacctcg acctgaatgg aagccggcgg cacctcgcta acggattcac cactccaaga
     1321 attggagcca atcaattctt gcggagaact gtgaatgcgc aaaccaaccc ttggcagaac
     1381 atatccatcg cgtccgccat ctccagcagc cgcacgcggc gcatctcggg cagcgttggg
     1441 tcctggccac gggtgcgcat gatcgtgctc ctgtcgttga ggacccggct aggctggcgg
     1501 ggttgcctta ctggttagca gaatgaatca ccgatacgcg agcgaacgtg aagcgactgc
     1561 tgctgcaaaa cgtctgcgac ctgagcaaca acatgaatgg tcttcggttt ccgtgtttcg
     1621 taaagtctgg aaacgcggaa gtcagcgccc tgcaccatta tgttccggat ctgcatcgca
     1681 ggatgctgct ggctaccctg tggaacacct acatctgtat taacgaagcg ctggcattga
     1741 ccctgagtga tttttctctg gtcccgccgc atccataccg ccagttgttt accctcacaa
     1801 cgttccagta accgggcatg ttcatcatca gtaacccgta tcgtgagcat cctctctcgt
     1861 ttcatcggta tcattacccc catgaacaga aatccccctt acacggaggc atcagtgacc
     1921 aaacaggaaa aaaccgccct taacatggcc cgctttatca gaagccagac attaacgctt
     1981 ctggagaaac tcaacgagct ggacgcggat gaacaggcag acatctgtga atcgcttcac
     2041 gaccacgctg atgagcttta ccgcagctgc ctcgcgcgtt tcggtgatga cggtgaaaac
     2101 ctctgacaca tgcagctccc ggagacggtc acagcttgtc tgtaagcgga tgccgggagc
     2161 agacaagccc gtcagggcgc gtcagcgggt gttggcgggt gtcggggcgc agccatgacc
     2221 cagtcacgta gcgatagcgg agtgtatact ggcttaacta tgcggcatca gagcagattg
     2281 tactgagagt gcaccatatg cggtgtgaaa taccgcacag atgcgtaagg agaaaatacc
     2341 gcatcaggcg ctcttccgct tcctcgctca ctgactcgct gcgctcggtc gttcggctgc
     2401 ggcgagcggt atcagctcac tcaaaggcgg taatacggtt atccacagaa tcaggggata
     2461 acgcaggaaa gaacatgtga gcaaaaggcc agcaaaaggc caggaaccgt aaaaaggccg
     2521 cgttgctggc gtttttccat aggctccgcc cccctgacga gcatcacaaa aatcgacgct
     2581 caagtcagag gtggcgaaac ccgacaggac tataaagata ccaggcgttt ccccctggaa
     2641 gctccctcgt gcgctctcct gttccgaccc tgccgcttac cggatacctg tccgcctttc
     2701 tcccttcggg aagcgtggcg ctttctcata gctcacgctg taggtatctc agttcggtgt
     2761 aggtcgttcg ctccaagctg ggctgtgtgc acgaaccccc cgttcagccc gaccgctgcg
     2821 ccttatccgg taactatcgt cttgagtcca acccggtaag acacgactta tcgccactgg
     2881 cagcagccac tggtaacagg attagcagag cgaggtatgt aggcggtgct acagagttct
     2941 tgaagtggtg gcctaactac ggctacacta gaaggacagt atttggtatc tgcgctctgc
     3001 tgaagccagt taccttcgga aaaagagttg gtagctcttg atccggcaaa caaaccaccg
     3061 ctggtagcgg tggttttttt gtttgcaagc agcagattac gcgcagaaaa aaaggatctc
     3121 aagaagatcc tttgatcttt tctacggggt ctgacgctca gtggaacgaa aactcacgtt
     3181 aagggatttt ggtcatgaga ttatcaaaaa ggatcttcac ctagatcctt ttaaattaaa
     3241 aatgaagttt taaatcaatc taaagtatat atgagtaaac ttggtctgac agttaccaat
     3301 gcttaatcag tgaggcacct atctcagcga tctgtctatt tcgttcatcc atagttgcct
     3361 gactccccgt cgtgtagata actacgatac gggagggctt accatctggc cccagtgctg
     3421 caatgatacc gcgagaccca cgctcaccgg ctccagattt atcagcaata aaccagccag
     3481 ccggaagggc cgagcgcaga agtggtcctg caactttatc cgcctccatc cagtctatta
     3541 attgttgccg ggaagctaga gtaagtagtt cgccagttaa tagtttgcgc aacgttgttg
     3601 ccattgctgc aggcatcgtg gtgtcacgct cgtcgtttgg tatggcttca ttcagctccg
     3661 gttcccaacg atcaaggcga gttacatgat cccccatgtt gtgcaaaaaa gcggttagct
     3721 ccttcggtcc tccgatcgtt gtcagaagta agttggccgc agtgttatca ctcatggtta
     3781 tggcagcact gcataattct cttactgtca tgccatccgt aagatgcttt tctgtgactg
     3841 gtgagtactc aaccaagtca ttctgagaat agtgtatgcg gcgaccgagt tgctcttgcc
     3901 cggcgtcaac acgggataat accgcgccac atagcagaac tttaaaagtg ctcatcattg
     3961 gaaaacgttc ttcggggcga aaactctcaa ggatcttacc gctgttgaga tccagttcga
     4021 tgtaacccac tcgtgcaccc aactgatctt cagcatcttt tactttcacc agcgtttctg
     4081 ggtgagcaaa aacaggaagg caaaatgccg caaaaaaggg aataagggcg acacggaaat
     4141 gttgaatact catactcttc ctttttcaat attattgaag catttatcag ggttattgtc
     4201 tcatgagcgg atacatattt gaatgtattt agaaaaataa acaaataggg gttccgcgca
     4261 catttccccg aaaagtgcca cctgacgtct aagaaaccat tattatcatg acattaacct
     4321 ataaaaatag gcgtatcacg aggccctttc gtcttcaaga a



Product is for research use only!

Search name

pBR322,Plasmid pBR322,pBR322 vector

No customer comments for the moment.

Add A Comment

Related Products


No products

Total $0.00

Prices don't include postage.
