pBS185 CMV-Cre

$260.00

  • Model: PVT12294
  • 20 Units in Stock
Ask a question


Add to Cart:

pBS185 CMV-Cre

PVT12294    2ug
 

 

pBS185 CMV-Cre Search name

pBS185 CMV-Cre,pBS185 CMV-Cre vector,pBS185 CMV-Cre plasmid,pBS185 CMV-Cre map

 

 

pBS185 CMV-Cre Information

Bacterial Resistance(s):   Amp

Screening:  
Growth Strain(s): DH5 alpha
Growth Condition: LB/37 Centigrade
Size: 6919bp

 

pBS185 CMV-Cre Sequence

agcgcccaatacgcaaaccgcctctccccgcgcgttggccgattcattaatgCAGCTGGCACGACAGGTTTCCCGACTGG
AAAGCGGGCAGTGAGCGCAACGCAATTAATGTGAGTTAGCTCACTCATTAGGCACCCCAGGCTTTACACTTTATGCTTCC
GGCTCGTATGTTGTGTGGAATTGTGAGCGGATAACAATTTCACACAGGAAACAGCTATGACATGATTACGAATTCGAGCT
CGGTACCCTCGACCAATTCCTGGCCTTCCTGCTGCTACATCTCAAATATCTTGATTACAGGCAGGACCCACGCTCTTTAT
CACTTTTTTTTCCATCTTTTTTTTTTTGGATATTTTCTTCGTTTATATTTCAAATGCTATCCCAAAAGTCCCCTATACCC
CACCCCTACCCCCACCCCGCTCCCCTACCCACTCACTCCCACTTCTTGGCCCTGGCTTTCCCCTGAACTGGGGCATATAG
TTTGCTAGACCAAGGGTCCTCTCTTCCCAGTGATGGCCAACTAGGCCATCTTCTGCTACATACGAAGCTAGATACACGAG
TTCAGGGGGTACTGGTTAGTTCAGATTGCTGTTCCACCTATAGGGTTGCAGATCCCTTTAGCTCCTTGGGTACTTTCTCT
AGCTCCTCCATTGGGGGCCCTGTGTTCCATCCAATAGCTGACTGTGAGCATCCACTTCTGTGTTTGCTGGGCACTGGCAA
AGCCTCACAGGAGACAGCTTTATCAGGGTCCTTTCAGCAAAATCTTGATGGCATATGCAATAGTGTCTGCATTTGGTGGC
TGAATAGGAGATGGCCTGGTGACACAGTCACTCCTGTAATCCCAGGTACTTGGGAAGCTGAGGCAGGAGAATCAAAAACT
CAAGGTCAGACTGGACTGCAGAATGAGTTCTAGGACAAGGTAAGCAACTTGTGTCAAAACAGCCAAGAAAGCCCCTCTGG
AATCTAGTTCAGTGTTAGTCCCTGCCTAGCATACGAGACACCCTATGTTAATTTTCATACCCACCTCCTTATACCCAACA
ATGTGAGAGGAAACCAGAATCCAAAGAGAATATAAATGATAAGATTTTCTGTGCTTCCAGGATGGGACATCAAGTCTTCC
AGGACCACCCTCCCTCCCTCCCTTCCCCTAACACAAGACCTGACCAGGCACACAGCTGTTTTCCATGAGGAAGCTTATGG
GATAGCTTGGCTTTACCCAAAGACATTACCCCTCTGTGAGGGCCAGAGGCGGGAGGTAAAGGCACGAGGGGGTCCAAAAC
CAGATCCCCAGACTATCAAGTCACCCCAGTTTCTTATTGCCAAACCACACCAAGAAAACCAGAGTTAGACTCAAACAGGC
TTTTATTATTCACGTACTCGGTAGAAAACGGGGGTTTAGTAAACAGGGTGGAACTGTATAGGAAGACGCTGGGTTGGTCC
GATACTATTTACACGTGGTGGCAGCGCTGTTCGTCACATCAGGCACAGCACGTGCACTTGTCCGCGGCGCCTTTGCAGAC
ACAGCCCTGGGCACATTTGGAGCAGCCCACGGGACAGCAGGAGCAGCAGCCTAGAAAGGAGGAGGAAGAGGTCAGCCTGG
CTGAAGACCTCTGCTTCCTGTCCCCAACAGAGAAGACCTCGGTTTTTTTAAATAGTTCTCTGTATAGTTCTGTCCCCGAG
ACAATACAATGGCCTCCGGGAAGCAAAGGACATTTCTCAGAGCCAGTTTTGTAGGAGTTCCCCGCCCCTAGCCTTAGCCG
CCACCCAAGGTGTCCCAACTCACTCTTCTTGCAGGAGGTGCACTTGCAGTTCTTGCAGGCGCAGGAGCTGGTGCAAGTGC
AGGAGCCGCCTGGGGAGGAGAAAGAAGACAGCATGAGGGAGGCAGCATTACAGCAGTGGCCAACACCACGAGTCCCGGCT
CAGTTCACTAAGTCCTCCTCGGAGCTGCAGGGAGCCTAGCCCCACTTTTCTCCTCACAGGTTAAGTCAGGGATTATGTCT
TTGAGTCCCAAGACATAAAGGTCCTTCACCTCTTTCTTAATTCAAGCAATTCACAGTAAGTTTAGTAATGCCTGGGACTC
AACCCAGATGTCCCCACTAACTGGGTGATCAGGAACCGGACATTTGCGCGTCTAAATCCTAGCCCCAACCCCGCCAAAGG
ACCCGTTCGACAATACTCGTAACTAATGAAGGCTTTTGCAAGAGCGGATTCTAGAAAGAACCGGAATGAATCGCCAACTA
AAGGTGCCTATTCCCGCCAAGCCTCTACAACTCGGGGATTCCGCTCTGCGGTCCCAACTTGGTATTCTAAAGACCAAGGA
TCGGGAGTCTTACCGGTGGAGCAGGAGCAGTTGGGGTCCATTCCGAGATCCCTCGACAATTCCAACCTTACCCAAGAGTT
CGCCAAACTCAGACATCACTTTAGCAAAACCGCGCCGTGCTTCTTCCTCGGTGGCATTCATCACGAAATGTTCAGCACTA
CGCATACTTTTGACAGGAAACGCAACGGATATTGAGTCAATATCAGGCATTCTATCGCTCAGCTTTACAGTGACAATGAC
GGCTGGCGACTGAATATTAGTGCTTACAGACAGCACTACATATTTTCCGTCGATGTTGAAATCCTTTCTCATATGTCACC
ATAAATATCAAATAATTATAGCAATCATTTACGCGTTAATGGCTAATCGCCATCTTCCAGCAGGCGCACCATTGCCCCTG
TTTCACTATCCAGGTTACGGATATAGTTCATGACAATATTTACATTGGTCCAGCCACCAGCTTGCATGATCTCCGGTATT
GAAACTCCAGCGCGGGCCATATCTCGCGCGGCTCCGACACGGGCACTGTGTCCAGACCAGGCCAGGTATCTCTGACCAGA
GTCATCCTTAGCGCCGTAAATCAATCGATGAGTTGCTTCAAAAATCCCTTCCAGGGCGCGAGTTGATAGCTGGCTGGTGG
CAGATGGCGCGGCAACACCATTTTTTCTGACCCGGCAAAACAGGTAGTTATTCGGATCATCAGCTACACCAGAGACGGAA
ATCCATCGCTCGACCAGTTTAGTTACCCCCAGGCTAAGTGCCTTCTCTACACCTGCGGTGCTAACCAGCGTTTTCGTTCT
GCCAATATGGATTAACATTCTCCCACCGTCAGTACGTGAGATATCTTTAACCCTGATCCTGGCAATTTCGGCTATACGTA
ACAGGGTGTTATAAGCAATCCCCAGAAATGCCAGATTACGTATATCCTGGCAGCGATCGCTATTTTCCATGAGTGAACGA
ACCTGGTCGAAATCAGTGCGTTCGAACGCTAGAGCCTGTTTTGCACGTTCACCGGCATCAACGTTTTCTTTTCGGATCCG
CCGCATAACCAGTGAAACAGCATTGCTGTCACTTGGTCGTGGCAGCCCGGACCGACGATGAAGCATGTTTAGCTGGCCCA
AATGTTGCTGGATAGTTTTTACTGCCAGACCGCGCGCCTGAAGATATAGAAGATAATCGCGAACATCTTCAGGTTCTGCG
GGAAACCATTTCCGGTTATTCAACTTGCACCATGCCGCCCACGACCGGCAAACGGACAGAAGCATTTTCCAGGTATGCTC
AGAAAACGCCTGGCGATCCCTGAACATGTCCATCAGGTTCTTGCGAACCTCATCACTCGTTGCATCGACCGGTAATGCAG
GCAAATTTTGGTGTACGGTCAGTAAATTGGACATTTCACACTCAGATAATGGTTTTAAGTAAAGTGTACAGGATCGGCTC
TGCCCCTCGAGGGGATCCTCTAGAGTCGGTGTCTTCTATGGAGGTCAAAACAGCGTGGATGGCGTCTCCAGGCGATCTGA
CGGTTCACTAAACGAGCTCTGCTTATATAGACCTCCCACCGTACACGCCTACCGCCCATTTGCGTCAATGGGGCGGAGTT
GTTACGACATTTTGGAAAGTCCCGTTGATTTTGGTGCCAAAACAAACTCCCATTGACGTCAATGGGGTGGAGACTTGGAA
ATCCCCGTGAGTCAAACCGCTATCCACGCCCATTGATGTACTGCCAAAACCGCATCACCATGGTAATAGCGATGACTAAT
ACGTAGATGTACTGCCAAGTAGGAAAGTCCCATAAGGTCATGTACTGGGCATAATGCCAGGCGGGCCATTTACCGTCATT
GACGTCAATAGGGGGCGTACTTGGCATATGATACACTTGATGTACTGCCAAGTGGGCAGTTTACCGTAAATACTCCACCC
ATTGACGTCAATGGAAAGTCCCTATTGGCGTTACTATGGGAACATACGTCATTATTGACGTCAATGGGCGGGGGTCGTTG
GGCGGTCAGCCAGGCGGGCCATTTACCGTAAGTTATGTAACGCGGAACTCCATATATGGGCTATGAACTAATGACCCCGT
AATTGATTACTATTAATAACTAGTCAATAATCAATGTCAACATGGCGGTAATGTTGGACATGAGCCAATATAAATGTACA
TATTATGATATGGATACAACGTATGCAATGGGCCAAGCTTGGCACTGGCCGTCGTTTTACAACGTCGTGACTGGGAAAAC
CCTGGCGTTACCCAACTTAATCGCCTTGCAGCACATCCCCCTTTCGCCAGCTGGCGTAATAGCGAAGAGGCCCGCACCGA
TCGCCCTTCCCAACAGTTGCGCAGCCTGAATGGCGAATGGCGCCTGATGCGGTATTTTCTCCTTACGCATCTGTGCGGTA
TTTCACACCGCATATGGTGCACTCTCAGTACAATCTGCTCTGATGCCGCATAGTTAAGCCAGCCCCGACACCCGCCAACA
CCCGCTGACGCGCCCTGACGGGCTTGTCTGCTCCCGGCATCCGCTTACAGACAAGCTGTGACCGTCTCCGGGAGCTGCAT
GTGTCAGAGGTTTTCACCGTCATCACCGAAACGCGCGAGACGAAAGGGCCTCGTGATACGCCTATTTTTATAGGTTAATG
TCATGATAATAATGGTTTCTTAGACGTCAGGTGGCACTTTTCGGGGAAATGTGCGCGGAACCCCTATTTGTTTATTTTTC
TAAATACATTCAAATATGTATCCGCTCATGAGACAATAACCCTGATAAATGCTTCAATAATATTGAAAAAGGAAGAGTAT
GAGTATTCAACATTTCCGTGTCGCCCTTATTCCCTTTTTTGCGGCATTTTGCCTTCCTGTTTTTGCTCACCCAGAAACGC
TGGTGAAAGTAAAAGATGCTGAAGATCAGTTGGGTGCACGAGTGGGTTACATCGAACTGGATCTCAACAGCGGTAAGATC
CTTGAGAGTTTTCGCCCCGAAGAACGTTTTCCAATGATGAGCACTTTTAAAGTTCTGCTATGTGGCGCGGTATTATCCCG
TATTGACGCCGGGCAAGAGCAACTCGGTCGCCGCATACACTATTCTCAGAATGACTTGGTTGAGTACTCACCAGTCACAG
AAAAGCATCTTACGGATGGCATGACAGTAAGAGAATTATGCAGTGCTGCCATAACCATGAGTGATAACACTGCGGCCAAC
TTACTTCTGACAACGATCGGAGGACCGAAGGAGCTAACCGCTTTTTTGCACAACATGGGGGATCATGTAACTCGCCTTGA
TCGTTGGGAACCGGAGCTGAATGAAGCCATACCAAACGACGAGCGTGACACCACGATGCCTGTAGCAATGGCAACAACGT
TGCGCAAACTATTAACTGGCGAACTACTTACTCTAGCTTCCCGGCAACAATTAATAGACTGGATGGAGGCGGATAAAGTT
GCAGGACCACTTCTGCGCTCGGCCCTTCCGGCTGGCTGGTTTATTGCTGATAAATCTGGAGCCGGTGAGCGTGGGTCTCG
CGGTATCATTGCAGCACTGGGGCCAGATGGTAAGCCCTCCCGTATCGTAGTTATCTACACGACGGGGAGTCAGGCAACTA
TGGATGAACGAAATAGACAGATCGCTGAGATAGGTGCCTCACTGATTAAGCATTGGTAACTGTCAGACCAAGTTTACTCA
TATATACTTTAGATTGATTTAAAACTTCATTTTTAATTTAAAAGGATCTAGGTGAAGATCCTTTTTGATAATCTCATGAC
CAAAATCCCTTAACGTGAGTTTTCGTTCCACTGAGCGTCAGACCCCGTAGAAAAGATCAAAGGATCTTCTTGAGATCCTT
TTTTTCTGCGCGTAATCTGCTGCTTGCAAACAAAAAAACCACCGCTACCAGCGGTGGTTTGTTTGCCGGATCAAGAGCTA
CCAACTCTTTTTCCGAAGGTAACTGGCTTCAGCAGAGCGCAGATACCAAATACTGTTCTTCTAGTGTAGCCGTAGTTAGG
CCACCACTTCAAGAACTCTGTAGCACCGCCTACATACCTCGCTCTGCTAATCCTGTTACCAGTGGCTGCTGCCAGTGGCG
ATAAGTCGTGTCTTACCGGGTTGGACTCAAGACGATAGTTACCGGATAAGGCGCAGCGGTCGGGCTGAACGGGGGGTTCG
TGCACACAGCCCAGCTTGGAGCGAACGACCTACACCGAACTGAGATACCTACAGCGTGAGCTATGAGAAAGCGCCACGCT
TCCCGAAGGGAGAAAGGCGGACAGGTATCCGGTAAGCGGCAGGGTCGGAACAGGAGAGCGCACGAGGGAGCTTCCAGGGG
GAAACGCCTGGTATCTTTATAGTCCTGTCGGGTTTCGCCACCTCTGACTTGAGCGTCGATTTTTGTGATGCTCGTCAGGG
GGGCGGAGCCTATGGAAAAACGCCAGCAACGCGGCCTTTTTACGGTTCCTGGCCTTTTGCTGGCCTTTTGCTCACATGTT
CTTTCCTGCGTTATCCCCTGATTCTGTGGATAACCGTATTACCGCCTTTGAGTGAGCTGATACCGCTCGCCGCAGCCGAA
CGACCGAGCGCAGCGAGTCAGTGAGCGAGGAAGCGGAAG

//

 

Caution:
Product is for research use only!

No customer comments for the moment.

Add A Comment

Related Products

Cart  

No products

Total $0.00

Prices don't include postage.

Cart