pBV220- EK

$260.00

  • Model: PVT10508
  • 50 Units in Stock
Ask a question


Add to Cart:

pBV220-EK

Catalog No. PVT10508
Packing 2ug

 

pBV220-EK Information
Function Protease plasmids

Promoter: pR/pL

Replicon: ColE ori

Terminator: rrnB T1, rrnB T2

Plasmids: protease expression plasmids

Plasmid label: EK

Prokaryotic resistance: ampicillin Ampicillin

Cloned strain: DH5 alpha

Culture conditions: 37 centigrade, aerobic, LB

Expression host: Escherichia coli

Culture conditions: 37 centigrade, aerobic, LB

Induction mode: 42 C induction

5'sequencing primers: pBV220-F: AAGAAGGGCAGCATTCAAAG

3'sequencing primers: pBV220-R: CTGCGTTCTGATTTAATCTG

 

Caution:

1. It is expressed as inclusion body in E. coli and needs renaturation.

2. Product is for research use only!

No customer comments for the moment.

Add A Comment

Related Products

Cart  

No products

Total $0.00

Prices don't include postage.

Cart