pBV220-OmpA-PDL-1 trap

$280.00

  • Model: PVT20963
  • 20 Units in Stock
Ask a question


Add to Cart:

pBV220-OmpA-PDL-1 trap

PVT20963    2ug

 

Product Name:pBV220-OmpA-PDL-1 trap
Replicon: pUC
Prokaryotic resistance: Amp
Growth Strain(s): DH5a
Host: Escherichia coli
Vector type: Protein expression
Fragment type: ORF
species:
Prokaryotic resistance: Amp
Resistance Marker:
Fluorescent labeling:

 

pBV220-OmpA-PDL-1 trap Sequence

GAATTCatgTTTCACACAGGAAACAGCTATGACCatgATTACGGATTCACTGGAACTCTAGATAACGAGGCGCAAAAAAT
GAAAAAGACAGCTATCGCGATTGCAGTGGCACTGGCAGGTTTCGCTACCGTCGCTCAGGCTATGAAATGGGTTACCTTCA
TCTCTCTGCTGTTCCTGTTCTCTTCTGCTTACTCTGGTTCTTGGCTGCTGGAAGTTCCGAACGGTCCGTGGCGTTCTCTG
ACCTTCTACCCGGCTTGGCTGACCGTTTCTGAAGGTGCTAACGCTACCTTCACCTGCTCTCTGTCTAACTGGTCTGAAGA
CCTGATGCTGAACTGGAACCGTCTGTCTCCGTCTAACCAGACCGAAAAACAGGCTGCTTTCTGCAACGGTCTGTCTCAGC
CGGTTCAGGACGCTCGTTTCCAGATCATCCAGCTGCCGAACCGTCACGACTTCCACATGAACATCCTGGACACCCGTCGT
AACGACTCTGGTATCTACCTGTGCGGTGCTATCTCTCTGCACCCGAAAGCTAAAATCGAAGAATCTCCGGGTGCTGAACT
GGTTGTTACCGAACGTATCCTGGAAGGTCCGCAGCCGCAGCCGAAACCGCAGCCGAAACCGGAACCGGAACCGCAGCCGC
AGGGTGGTTCTGAAGAAGACCCGTGCGCTTGCGAATCTATCCTGAAATTCGAAGCTAAAGTTGAAGGTCTGCTGCAGGCT
CTGACCCGTAAACTGGAAGCTGTTTCTGGTCGTCTGGCTGTTCTGGAAAACCGTATCATCGCTGCTGCTGGTGCTCCGGT
TCCGTACCCGGACCCGCTGGAACCGCGTGGTGGTTCTCACCACCACCACCACCACTAAGGATCCGTCGACCTGCAGCCAA
GCTTGGCTGTTTTGGCGGATGAGAGAAGATTTTCAGCCTGATACAGATTAAATCAGAACGCAGAAGCGGTCTGATAAAAC
AGAATTTGCCTGGCGGCAGTAGCGCGGTGGTCCCACCTGACCCCATGCCGAACTCAGAAGTGAAACGCCGTAGCGCCGAT
GGTAGTGTGGGGTCTCCCCATGCGAGAGTAGGGAACTGCCAGGCATCAAATAAAACGAAAGGCTCAGTCGAAAGACTGGG
CCTTTCGTTTTATCTGTTGTTTGTCGGTGAACGCTCTCCTGAGTAGGACAAATCCGCCGGGAGCGGATTTGAACGTTGCG
AAGCAACGGCCCGGAGGGTGGCGGGCAGGACGCCCGCCATAAACTGCCAGGCATCAAATTAAGCAGAAGGCCATCCTGAC
GGATGGCCTTTTTGCGTTTCTACAAACTCTTTTGTTTATTTTTCTAAATACATTCAAATATGTATCCGCTCATGAGACAA
TAACCCTGATAAATGCTTCAATAATATTGAAAAAGGAAGAGTATGAGTATTCAACATTTCCGTGTCGCCCTTATTCCCTT
TTTTGCGGCATTTTGCCTTCCTGTTTTTGCTCACCCAGAAACGCTGGTGAAAGTAAAAGATGCTGAAGATCAGTTGGGTG
CACGAGTGGGTTACATCGAACTGGATCTCAACAGCGGTAAGATCCTTGAGAGTTTTCGCCCCGAAGAACGTTTTCCAATG
ATGAGCACTTTTAAAGTTCTGCTATGTGGCGCGGTATTATCCCGTGTTGACGCCGGGCAAGAGCAACTCGGTCGCCGCAT
ACACTATTCTCAGAATGACTTGGTTGAGTACTCACCAGTCACAGAAAAGCATCTTACGGATGGCATGACAGTAAGAGAAT
TATGCAGTGCTGCCATAACCATGAGTGATAACACTGCGGCCAACTTACTTCTGACAACGATCGGAGGACCGAAGGAGCTA
ACCGCTTTTTTGCACAACATGGGGGATCATGTAACTCGCCTTGATCGTTGGGAACCGGAGCTGAATGAAGCCATACCAAA
CGACGAGCGTGACACCACGATGCCTGTAGCAATGGCAACAACGTTGCGCAAACTATTAACTGGCGAACTACTTACTCTAG
CTTCCCGGCAACAATTAATAGACTGGATGGAGGCGGATAAAGTTGCAGGACCACTTCTGCGCTCGGCCCTTCCGGCTGGC
TGGTTTATTGCTGATAAATCTGGAGCCGGTGAGCGTGGGTCTCGCGGTATCATTGCAGCACTGGGGCCAGATGGTAAGCC
CTCCCGTATCGTAGTTATCTACACGACGGGGAGTCAGGCAACTATGGATGAACGAAATAGACAGATCGCTGAGATAGGTG
CCTCACTGATTAAGCATTGGTAACTGTCAGACCAAGTTTACTCATATATACTTTAGATTGATTTAAAACTTCATTTTTAA
TTTAAAAGGATCTAGGTGAAGATCCTTTTTGATAATCTCATGACCAAAATCCCTTAACGTGAGTTTTCGTTCCACTGAGC
GTCAGACCCCGTAGAAAAGATCAAAGGATCTTCTTGAGATCCTTTTTTTCTGCGCGTAATCTGCTGCTTGCAAACAAAAA
AACCACCGCTACCAGCGGTGGTTTGTTTGCCGGATCAAGAGCTACCAACTCTTTTTCCGAAGGTAACTGGCTTCAGCAGA
GCGCAGATACCAAATACTGTTCTTCTAGTGTAGCCGTAGTTAGGCCACCACTTCAAGAACTCTGTAGCACCGCCTACATA
CCTCGCTCTGCTAATCCTGTTACCAGTGGCTGCTGCCAGTGGCGATAAGTCGTGTCTTACCGGGTTGGACTCAAGACGAT
AGTTACCGGATAAGGCGCAGCGGTCGGGCTGAACGGGGGGTTCGTGCACACAGCCCAGCTTGGAGCGAACGACCTACACC
GAACTGAGATACCTACAGCGTGAGCTATGAGAAAGCGCCACGCTTCCCGAAGGGAGAAAGGCGGACAGGTATCCGGTAAG
CGGCAGGGTCGGAACAGGAGAGCGCACGAGGGAGCTTCCAGGGGGAAACGCCTGGTATCTTTATAGTCCTGTCGGGTTTC
GCCACCTCTGACTTGAGCGTCGATTTTTGTGATGCTCGTCAGGGGGGCGGAGCCTATGGAAAAACGCCAGCAACGCGGCC
TTTTTACGGTTCCTGGCCTTTTGCTGGCCTTTTGCTCACATGTTCTTTCCTGCGTTATCCCCTGATTCTGTGGATAACCG
TATTACCGCCTTTGAGTGAGCTGATACCGCTCGCCGCAGCCGAACGACCGAGCGCAGCGAGTCAGTGAGCGAGGAAGCGG
AAGAGCGCTTATCTTTCCCTTTATTTTTGCTGCGGTAAGTCGCATAAAAACCATTCTTCATAATTCAATCCATTTACTAT
GTTATGTTCTGAGGGGAGTGAAAATTCCCCTAATTCGATGAAGATTCTTGCTCAATTGTTATCAGCTATGCGCCGACCAG
AACACCTTGCCGATCAGCCAAACGTCTCTTCAGGCCACTGACTAGCGATAACTTTCCCCACAACGGAACAACTCTCATTG
CATGGGATCATTGGGTACTGTGGGTTTAGTGGTTGTAAAAACACCTGACCGCTATCCCTGATCAGTTTCTTGAAGGTAAA
CTCATCACCCCCAAGTCTGGCTATGCAGAAATCACCTGGCTCAACAGCCTGCTCAGGGTCAACGAGAATTAACATTCCGT
CAGGAAAGCTTGGCTTGGAGCCTGTTGGTGCGGTCATGGAATTACCTTCAACCTCAAGCCAGAATGCAGAATCACTGGCT
TTTTTGGTTGTGCTTACCCATCTCTCCGCATCACCTTTGGTAAAGGTTCTAAGCTTAGGTGAGAACATCCCTGCCTGAAC
ATGAGAAAAAACAGGGTACTCATACTCACTTCTAAGTGACGGCTGCATACTAACCGCTTCATACATCTCGTAGATTTCTC
TGGCGATTGAAGGGCTAAATTCTTCAACGCTAACTTTGAGAATTTTTGTAAGCAATGCGGCGTTATAAGCATTTAATGCA
TTGATGCCATTAAATAAAGCACCAACGCCTGACTGCCCCATCCCCATCTTGTCTGCGACAGATTCCTGGGATAAGCCAAG
TTCATTTTTCTTTTTTTCATAAATTGCTTTAAGGCGACGTGCGTCCTCAAGCTGCTCTTGTGTTAATGGTTTCTTTTTTG
TGCTCATACGTTAAATCTATCACCGCAAGGGATAAATATCTAACACCGTGCGTGTTGACTATTTTACCTCTGGCGGTGAT
AATGGTTGCATGTACTAAGGAGGTTGTATGGAACAACGCATAACCCTGAAAGATTATGCAATGCGCTTTGGGCAAACCAA
GACAGCTAAAGATCTCTCACCTACCAAACAATGCCCCCCTGCAAAAAATAAATTCATATAAAAAACATACAGATAACCAT
CTGCGGTGATAAATTATCTCTGGCGGTGTTGACATAAATACCACTGGCGGTGATACTGAGCACATCAGCAGGACGCACTG
ACCACCATGAAGGTGACGCTCTTAAAAATTAAGCCCTGAAGAAGGGCAGCATTCAAAGCAGAAGGCTTTGGGGTGTGTGA
TACGAAACGAAGCATTGGTTAAAAATTAAGGAGG

//

 

*For Lab research use only

No customer comments for the moment.

Add A Comment

Related Products

Cart  

No products

Total $0.00

Prices don't include postage.

Cart