pCAG- GFP Plasmid


  • Model: PVT1036
  • 50 Units in Stock
Ask a question

Add to Cart:

pCAG-GFP Plasmid

PVT1036  2ug


pCAG-GFP Information

Promoter: CAG promoter
Replicon: ori, SV40 ori
Terminator: β-globin poly(A) signal
Plasmid Category: Breast-feeding Plasmids; Mammalian Expression Plasmids; pCAG Plasmids
Plasmid Size: 5556bp
Prokaryotic resistance: Ampicillin Amp (100 μg/ml)
Filtering Marker: C-EGFP
Cloning strains: E. coli DH5α
Culture conditions: 37°C, aerobic, LB
Expression host: 293T and other mammalian cells
Culture conditions: 37°C, 5% CO2
Induction mode: No induction, transient expression
3' Sequencing Primer: β-globin-R (GTCCTTCCGAGTGAGAGACAC)


pCAG-GFP Desciption

pCAG-GFP is a plasmid that can be expressed in mammalian cells. The CAG promoter drives the fusion expression of the target gene and the green fluorescent protein EGFP, and can be cloned into the desired gene using EcoRI, KpnI, and XmaI restriction sites.



pCAG-GFP Sequence

LOCUS       Exported                5556 bp ds-DNA     circular SYN 19-9-2016
DEFINITION  synthetic circular DNA
SOURCE      synthetic DNA construct
  ORGANISM  synthetic DNA construct
REFERENCE   1  (bases 1 to 5556)
  TITLE     Direct Submission
  JOURNAL   Exported 2016-09-19  
FEATURES             Location/Qualifiers
     source          1..5556
                     /organism="synthetic DNA construct"
                     /mol_type="other DNA"
     enhancer        4..383
                     /note="CMV enhancer"
                     /note="human cytomegalovirus immediate early enhancer"
     promoter        386..661
                     /note="chicken beta-actin promoter"
     CDS             1773..2492
                     /product="enhanced GFP"
                     /note="mammalian codon-optimized"
     polyA_site      2644..2699
                     /note="beta-globin poly(A) signal"
                     /note="rabbit beta-globin polyadenylation signal"
     primer_bind     complement(3059..3075)
                     /note="M13 rev"
                     /note="common sequencing primer, one of multiple similar
     protein_bind    3083..3099
                     /bound_moiety="lac repressor encoded by lacI"
                     /note="lac operator"
                     /note="The lac repressor binds to the lac operator to
                     inhibit transcription in E. coli. This inhibition can be
                     relieved by adding lactose or
                     isopropyl-beta-D-thiogalactopyranoside (IPTG)."
     promoter        complement(3107..3137)
                     /note="lac promoter"
                     /note="promoter for the E. coli lac operon"
     protein_bind    3152..3173
                     /bound_moiety="E. coli catabolite activator protein"
                     /note="CAP binding site"
                     /note="CAP binding activates transcription in the presence
                     of cAMP."
     promoter        3232..3427
                     /note="SV40 promoter"
                     /note="SV40 early promoter"
     rep_origin      3278..3413
                     /note="SV40 ori"
                     /note="SV40 origin of replication"
     polyA_signal    3433..3567
                     /note="SV40 poly(A) signal"
                     /note="SV40 polyadenylation signal"
     rep_origin      complement(3806..4394)
                     /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of
     CDS             complement(4565..5425)
                     /note="confers resistance to ampicillin, carbenicillin, and
                     related antibiotics"
     promoter        complement(5426..5530)
                     /note="AmpR promoter"
        1 gtcgacattg attattgact agttattaat agtaatcaat tacggggtca ttagttcata
       61 gcccatatat ggagttccgc gttacataac ttacggtaaa tggcccgcct ggctgaccgc
      121 ccaacgaccc ccgcccattg acgtcaataa tgacgtatgt tcccatagta acgccaatag
      181 ggactttcca ttgacgtcaa tgggtggact atttacggta aactgcccac ttggcagtac
      241 atcaagtgta tcatatgcca agtacgcccc ctattgacgt caatgacggt aaatggcccg
      301 cctggcatta tgcccagtac atgaccttat gggactttcc tacttggcag tacatctacg
      361 tattagtcat cgctattacc atgggtcgag gtgagcccca cgttctgctt cactctcccc
      421 atctcccccc cctccccacc cccaattttg tatttattta ttttttaatt attttgtgca
      481 gcgatggggg cggggggggg gggggcgcgc gccaggcggg gcggggcggg gcgaggggcg
      541 gggcggggcg aggcggagag gtgcggcggc agccaatcag agcggcgcgc tccgaaagtt
      601 tccttttatg gcgaggcggc ggcggcggcg gccctataaa aagcgaagcg cgcggcgggc
      661 gggagtcgct gcgttgcctt cgccccgtgc cccgctccgc gccgcctcgc gccgcccgcc
      721 ccggctctga ctgaccgcgt tactcccaca ggtgagcggg cgggacggcc cttctcctcc
      781 gggctgtaat tagcgcttgg tttaatgacg gctcgtttct tttctgtggc tgcgtgaaag
      841 ccttaaaggg ctccgggagg gccctttgtg cgggggggag cggctcgggg ggtgcgtgcg
      901 tgtgtgtgtg cgtggggagc gccgcgtgcg gcccgcgctg cccggcggct gtgagcgctg
      961 cgggcgcggc gcggggcttt gtgcgctccg cgtgtgcgcg aggggagcgc ggccgggggc
     1021 ggtgccccgc ggtgcggggg ggctgcgagg ggaacaaagg ctgcgtgcgg ggtgtgtgcg
     1081 tgggggggtg agcagggggt gtgggcgcgg cggtcgggct gtaacccccc cctgcacccc
     1141 cctccccgag ttgctgagca cggcccggct tcgggtgcgg ggctccgtgc ggggcgtggc
     1201 gcggggctcg ccgtgccggg cggggggtgg cggcaggtgg gggtgccggg cggggcgggg
     1261 ccgcctcggg ccggggaggg ctcgggggag gggcgcggcg gcccccggag cgccggcggc
     1321 tgtcgaggcg cggcgagccg cagccattgc cttttatggt aatcgtgcga gagggcgcag
     1381 ggacttcctt tgtcccaaat ctgtgcggag ccgaaatctg ggaggcgccg ccgcaccccc
     1441 tctagcgggc gcggggcgaa gcggtgcggc gccggcagga aggaaatggg cggggagggc
     1501 cttcgtgcgt cgccgcgccg ccgtcccctt ctccctctcc agcctcgggg ctgtccgcgg
     1561 ggggacggct gccttcgggg gggacggggc agggcggggt tcggcttctg gcgtgtgacc
     1621 ggcggctcta gagcctctgc taaccatgtt catgccttct tctttttcct acagctcctg
     1681 ggcaacgtgc tggttattgt gctgtctcat cattttggca aagaattctg cagtcgacgg
     1741 taccgcgggc ccgggatcca ccggtcgcca ccatggtgag caagggcgag gagctgttca
     1801 ccggggtggt gcccatcctg gtcgagctgg acggcgacgt aaacggccac aagttcagcg
     1861 tgtccggcga gggcgagggc gatgccacct acggcaagct gaccctgaag ttcatctgca
     1921 ccaccggcaa gctgcccgtg ccctggccca ccctcgtgac caccctgacc tacggcgtgc
     1981 agtgcttcag ccgctacccc gaccacatga agcagcacga cttcttcaag tccgccatgc
     2041 ccgaaggcta cgtccaggag cgcaccatct tcttcaagga cgacggcaac tacaagaccc
     2101 gcgccgaggt gaagttcgag ggcgacaccc tggtgaaccg catcgagctg aagggcatcg
     2161 acttcaagga ggacggcaac atcctggggc acaagctgga gtacaactac aacagccaca
     2221 acgtctatat catggccgac aagcagaaga acggcatcaa ggtgaacttc aagatccgcc
     2281 acaacatcga ggacggcagc gtgcagctcg ccgaccacta ccagcagaac acccccatcg
     2341 gcgacggccc cgtgctgctg cccgacaacc actacctgag cacccagtcc gccctgagca
     2401 aagaccccaa cgagaagcgc gatcacatgg tcctgctgga gttcgtgacc gccgccggga
     2461 tcactctcgg catggacgag ctgtacaagt aaagcggccg cactcctcag gtgcaggctg
     2521 cctatcagaa ggtggtggct ggtgtggcca atgccctggc tcacaaatac cactgagatc
     2581 tttttccctc tgccaaaaat tatggggaca tcatgaagcc ccttgagcat ctgacttctg
     2641 gctaataaag gaaatttatt ttcattgcaa tagtgtgttg gaattttttg tgtctctcac
     2701 tcggaaggac atatgggagg gcaaatcatt taaaacatca gaatgagtat ttggtttaga
     2761 gtttggcaac atatgcccat atgctggctg ccatgaacaa aggtggctat aaagaggtca
     2821 tcagtatatg aaacagcccc ctgctgtcca ttccttattc catagaaaag ccttgacttg
     2881 aggttagatt ttttttatat tttgttttgt gttatttttt tctttaacat ccctaaaatt
     2941 ttccttacat gttttactag ccagattttt cctcctctcc tgactactcc cagtcatagc
     3001 tgtccctctt ctcttatgaa gatccctcga cctgcagccc aagcttggcg taatcatggt
     3061 catagctgtt tcctgtgtga aattgttatc cgctcacaat tccacacaac atacgagccg
     3121 gaagcataaa gtgtaaagcc tggggtgcct aatgagtgag ctaactcaca ttaattgcgt
     3181 tgcgctcact gcccgctttc cagtcgggaa acctgtcgtg ccagcggatc cgcatctcaa
     3241 ttagtcagca accatagtcc cgcccctaac tccgcccatc ccgcccctaa ctccgcccag
     3301 ttccgcccat tctccgcccc atggctgact aatttttttt atttatgcag aggccgaggc
     3361 cgcctcggcc tctgagctat tccagaagta gtgaggaggc ttttttggag gcctaggctt
     3421 ttgcaaaaag ctaacttgtt tattgcagct tataatggtt acaaataaag caatagcatc
     3481 acaaatttca caaataaagc atttttttca ctgcattcta gttgtggttt gtccaaactc
     3541 atcaatgtat cttatcatgt ctggatccgc tgcattaatg aatcggccaa cgcgcgggga
     3601 gaggcggttt gcgtattggg cgctcttccg cttcctcgct cactgactcg ctgcgctcgg
     3661 tcgttcggct gcggcgagcg gtatcagctc actcaaaggc ggtaatacgg ttatccacag
     3721 aatcagggga taacgcagga aagaacatgt gagcaaaagg ccagcaaaag gccaggaacc
     3781 gtaaaaaggc cgcgttgctg gcgtttttcc ataggctccg cccccctgac gagcatcaca
     3841 aaaatcgacg ctcaagtcag aggtggcgaa acccgacagg actataaaga taccaggcgt
     3901 ttccccctgg aagctccctc gtgcgctctc ctgttccgac cctgccgctt accggatacc
     3961 tgtccgcctt tctcccttcg ggaagcgtgg cgctttctca atgctcacgc tgtaggtatc
     4021 tcagttcggt gtaggtcgtt cgctccaagc tgggctgtgt gcacgaaccc cccgttcagc
     4081 ccgaccgctg cgccttatcc ggtaactatc gtcttgagtc caacccggta agacacgact
     4141 tatcgccact ggcagcagcc actggtaaca ggattagcag agcgaggtat gtaggcggtg
     4201 ctacagagtt cttgaagtgg tggcctaact acggctacac tagaaggaca gtatttggta
     4261 tctgcgctct gctgaagcca gttaccttcg gaaaaagagt tggtagctct tgatccggca
     4321 aacaaaccac cgctggtagc ggtggttttt ttgtttgcaa gcagcagatt acgcgcagaa
     4381 aaaaaggatc tcaagaagat cctttgatct tttctacggg gtctgacgct cagtggaacg
     4441 aaaactcacg ttaagggatt ttggtcatga gattatcaaa aaggatcttc acctagatcc
     4501 ttttaaatta aaaatgaagt tttaaatcaa tctaaagtat atatgagtaa acttggtctg
     4561 acagttacca atgcttaatc agtgaggcac ctatctcagc gatctgtcta tttcgttcat
     4621 ccatagttgc ctgactcccc gtcgtgtaga taactacgat acgggagggc ttaccatctg
     4681 gccccagtgc tgcaatgata ccgcgagacc cacgctcacc ggctccagat ttatcagcaa
     4741 taaaccagcc agccggaagg gccgagcgca gaagtggtcc tgcaacttta tccgcctcca
     4801 tccagtctat taattgttgc cgggaagcta gagtaagtag ttcgccagtt aatagtttgc
     4861 gcaacgttgt tgccattgct acaggcatcg tggtgtcacg ctcgtcgttt ggtatggctt
     4921 cattcagctc cggttcccaa cgatcaaggc gagttacatg atcccccatg ttgtgcaaaa
     4981 aagcggttag ctccttcggt cctccgatcg ttgtcagaag taagttggcc gcagtgttat
     5041 cactcatggt tatggcagca ctgcataatt ctcttactgt catgccatcc gtaagatgct
     5101 tttctgtgac tggtgagtac tcaaccaagt cattctgaga atagtgtatg cggcgaccga
     5161 gttgctcttg cccggcgtca atacgggata ataccgcgcc acatagcaga actttaaaag
     5221 tgctcatcat tggaaaacgt tcttcggggc gaaaactctc aaggatctta ccgctgttga
     5281 gatccagttc gatgtaaccc actcgtgcac ccaactgatc ttcagcatct tttactttca
     5341 ccagcgtttc tgggtgagca aaaacaggaa ggcaaaatgc cgcaaaaaag ggaataaggg
     5401 cgacacggaa atgttgaata ctcatactct tcctttttca atattattga agcatttatc
     5461 agggttattg tctcatgagc ggatacatat ttgaatgtat ttagaaaaat aaacaaatag
     5521 gggttccgcg cacatttccc cgaaaagtgc cacctg



Product is for research use only!


Search name

pCAG-GFP,Plasmid pCAG-GFP,pCAG-GFP vector

No customer comments for the moment.

Add A Comment

Related Products


No products

Total $0.00

Prices don't include postage.
