
  • Model: PVT1020
  • 45 Units in Stock
Ask a question

Add to Cart:


PVT1020  2ug                                                                                Data sheet 

pCAGGS Information

Promoter: CAG promoter

Replicator: SV40 ori, ori

Terminator: beta -globin poly (A) signal

Plasmid classification: lactation serial plasmid; lactation expression plasmid; pCAG series plasmid.

Plasmid size: 4801bp

Prokaryotic resistance: ampicillin Amp (100 u g/ml)

Cloned strains of Escherichia coli, DH5 A and other Escherichia coli

Culture conditions: 37 centigrade, aerobic, LB

Expression host: mammalian cells such as 293T

Culture conditions: 37 C, 5%CO2

Induction mode: no induction, instantaneous expression

5'sequencing primers: pcaggs-F (GTTCGGCTTCTGGCGTGT)

3'sequencing primers: pcaggs-R (TATGTCCTTCCGAGTGAGAG)


pCAGGS Description

pCAGGS plasmid can be used to express gene efficiently under the control of chicken b- actin, rabbit b- globulin heterozygous promoter (CAG), and human CMV-IE enhancer in various mammalian cells. The CAG promoter sequence is part of the chicken b- actin promoter, the first exon and the first intron (it seems to have strong enhanced subtype activity. " It is linked to the rabbit b- globin fragment, the 3'part of the second intron includes the branching point needed for normal splicing reaction and the 5' portion of the third exon.

This plasmid is useful for highly efficient expression of genes under the control of the AG promoter and the human CMV-IE enhancer in various mammalian cells.The AG promoter sequence consists of the chicken β-actin promoter, the first exon and part of the first intron (that seems to have a strong enhancer-like activity) linked to a rabbit β-globin fragment, consisting of a 3' part of the second intron (inclusive a branch point which is required for normal splicing reactions) and a 5' part of the third exon.When cloning a fragment downstream from the lac promoter it may be advisable to use lacIq strains in order to prevent fortuitous expression of a possibly noxious polypeptide.



pCAGGS Sequence

LOCUS       Exported                4801 bp ds-DNA     circular SYN 18-MAY-2017

DEFINITION  synthetic circular DNA


SOURCE      synthetic DNA construct

  ORGANISM  synthetic DNA construct

REFERENCE   1  (bases 1 to 4801)

  TITLE     Direct Submission

  JOURNAL   Exported Thursday, May 18, 2017

FEATURES             Location/Qualifiers

     source          1..4801

                     /organism="synthetic DNA construct"

                     /mol_type="other DNA"

     polyA_site      158..213

                     /note="beta-globin poly(A) signal"

                     /note="rabbit beta-globin polyadenylation signal"

     primer_bind     complement(574..590)

                     /note="M13 rev"

                     /note="common sequencing primer, one of multiple similar 


     protein_bind    598..614

                     /bound_moiety="lac repressor encoded by lacI"

                     /note="lac operator"

                     /note="The lac repressor binds to the lac operator to 

                     inhibit transcription in E. coli. This inhibition can be 

                     relieved by adding lactose or 

                     isopropyl-beta-D-thiogalactopyranoside (IPTG)."

     promoter        complement(622..652)

                     /note="lac promoter"

                     /note="promoter for the E. coli lac operon"

     protein_bind    666..687

                     /bound_moiety="E. coli catabolite activator protein"

                     /note="CAP binding site"

                     /note="CAP binding activates transcription in the presence 

                     of cAMP."

     promoter        746..941

                     /note="SV40 promoter"

                     /note="SV40 early promoter"

     rep_origin      792..927

                     /note="SV40 ori"

                     /note="SV40 origin of replication"

     polyA_signal    947..1081

                     /note="SV40 poly(A) signal"

                     /note="SV40 polyadenylation signal"

     rep_origin      complement(1319..1907)



                     /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of 


     CDS             complement(2078..2938)





                     /note="confers resistance to ampicillin, carbenicillin, and

                     related antibiotics"







     promoter        complement(2939..3043)


                     /note="AmpR promoter"

     enhancer        3074..3453

                     /note="CMV enhancer"

                     /note="human cytomegalovirus immediate early enhancer"

     promoter        3455..3732

                     /note="chicken beta-actin promoter"

     intron          3733..4750

                     /note="chimeric intron"

                     /note="chimera between introns from chicken beta-actin and 

                     rabbit beta-globin"


        1 ttcctcgagg aattcactcc tcaggtgcag gctgcctatc agaaggtggt ggctggtgtg

       61 gccaatgccc tggctcacaa ataccactga gatctttttc cctctgccaa aaattatggg

      121 gacatcatga agccccttga gcatctgact tctggctaat aaaggaaatt tattttcatt

      181 gcaatagtgt gttggaattt tttgtgtctc tcactcggaa ggacatatgg gagggcaaat

      241 catttaaaac atcagaatga gtatttggtt tagagtttgg caacatatgc ccatatgctg

      301 gctgccatga acaaaggttg gctataaaga ggtcatcagt atatgaaaca gccccctgct

      361 gtccattcct tattccatag aaaagccttg acttgaggtt agattttttt tatattttgt

      421 tttgtgttat ttttttcttt aacatcccta aaattttcct tacatgtttt actagccaga

      481 tttttcctcc tctcctgact actcccagtc atagctgtcc ctcttctctt atggagatcc

      541 ctcgacctgc agcccaagct tggcgtaatc atggtcatag ctgtttcctg tgtgaaattg

      601 ttatccgctc acaattccac acaacatacg agccggaagc ataaagtgta aagcctgggt

      661 gcctaatgag tgagctaact cacattaatt gcgttgcgct cactgcccgc tttccagtcg

      721 ggaaacctgt cgtgccagcg gatccgcatc tcaattagtc agcaaccata gtcccgcccc

      781 taactccgcc catcccgccc ctaactccgc ccagttccgc ccattctccg ccccatggct

      841 gactaatttt ttttatttat gcagaggccg aggccgcctc ggcctctgag ctattccaga

      901 agtagtgagg aggctttttt ggaggcctag gcttttgcaa aaagctaact tgtttattgc

      961 agcttataat ggttacaaat aaagcaatag catcacaaat ttcacaaata aagcattttt

     1021 ttcactgcat tctagttgtg gtttgtccaa actcatcaat gtatcttatc atgtctggat

     1081 ccgctgcatt aatgaatcgg ccaacgcgcg gggagaggcg gtttgcgtat tgggcgctct

     1141 tccgcttcct cgctcactga ctcgctgcgc tcggtcgttc ggctgcggcg agcggtatca

     1201 gctcactcaa aggcggtaat acggttatcc acagaatcag ggataacgca ggaaagaaca

     1261 tgtgagcaaa aggccagcaa aaggccagga accgtaaaaa ggccgcgttg ctggcgtttt

     1321 tccataggct ccgcccccct gacgagcatc acaaaaatcg acgctcaagt cagaggtggc

     1381 gaaacccgac aggactataa agataccagg cgtttccccc tggaagctcc ctcgtgcgct

     1441 ctcctgttcc gaccctgccg cttaccggat acctgtccgc ctttctccct tcgggaagcg

     1501 tggcgctttc tcatagctca cgctgtaggt atctcagttc ggtgtaggtc gttcgctcca

     1561 agctgggctg tgtgcacgaa ccccccgttc agcccgaccg ctgcgcctta tccggtaact

     1621 atcgtcttga gtccaacccg gtaagacacg acttatcgcc actggcagca gccactggta

     1681 acaggattag cagagcgagg tatgtaggcg gtgctacaga gttcttgaag tggtggccta

     1741 actacggcta cactagaaga acagtatttg gtatctgcgc tctgctgaag ccagttacct

     1801 tcggaaaaag agttggtagc tcttgatccg gcaaacaaac caccgctggt agcggtggtt

     1861 tttttgtttg caagcagcag attacgcgca gaaaaaaagg atctcaagaa gatcctttga

     1921 tcttttctac ggggtctgac gctcagtgga acgaaaactc acgttaaggg attttggtca

     1981 tgagattatc aaaaaggatc ttcacctaga tccttttaaa ttaaaaatga agttttaaat

     2041 caatctaaag tatatatgag taaacttggt ctgacagtta ccaatgctta atcagtgagg

     2101 cacctatctc agcgatctgt ctatttcgtt catccatagt tgcctgactc cccgtcgtgt

     2161 agataactac gatacgggag ggcttaccat ctggccccag tgctgcaatg ataccgcgag

     2221 acccacgctc accggctcca gatttatcag caataaacca gccagccgga agggccgagc

     2281 gcagaagtgg tcctgcaact ttatccgcct ccatccagtc tattaattgt tgccgggaag

     2341 ctagagtaag tagttcgcca gttaatagtt tgcgcaacgt tgttgccatt gctacaggca

     2401 tcgtggtgtc acgctcgtcg tttggtatgg cttcattcag ctccggttcc caacgatcaa

     2461 ggcgagttac atgatccccc atgttgtgca aaaaagcggt tagctccttc ggtcctccga

     2521 tcgttgtcag aagtaagttg gccgcagtgt tatcactcat ggttatggca gcactgcata

     2581 attctcttac tgtcatgcca tccgtaagat gcttttctgt gactggtgag tactcaacca

     2641 agtcattctg agaatagtgt atgcggcgac cgagttgctc ttgcccggcg tcaatacggg

     2701 ataataccgc gccacatagc agaactttaa aagtgctcat cattggaaaa cgttcttcgg

     2761 ggcgaaaact ctcaaggatc ttaccgctgt tgagatccag ttcgatgtaa cccactcgtg

     2821 cacccaactg atcttcagca tcttttactt tcaccagcgt ttctgggtga gcaaaaacag

     2881 gaaggcaaaa tgccgcaaaa aagggaataa gggcgacacg gaaatgttga atactcatac

     2941 tcttcctttt tcaatattat tgaagcattt atcagggtta ttgtctcatg agcggataca

     3001 tatttgaatg tatttagaaa aataaacaaa taggggttcc gcgcacattt ccccgaaaag

     3061 tgccacctgg gtcgacattg attattgact agttattaat agtaatcaat tacggggtca

     3121 ttagttcata gcccatatat ggagttccgc gttacataac ttacggtaaa tggcccgcct

     3181 ggctgaccgc ccaacgaccc ccgcccattg acgtcaataa tgacgtatgt tcccatagta

     3241 acgccaatag ggactttcca ttgacgtcaa tgggtggagt atttacggta aactgcccac

     3301 ttggcagtac atcaagtgta tcatatgcca agtacgcccc ctattgacgt caatgacggt

     3361 aaatggcccg cctggcatta tgcccagtac atgaccttat gggactttcc tacttggcag

     3421 tacatctacg tattagtcat cgctattacc atggtcgagg tgagccccac gttctgcttc

     3481 actctcccca tctccccccc ctccccaccc ccaattttgt atttatttat tttttaatta

     3541 ttttgtgcag cgatgggggc gggggggggg ggggggcccc ccccaggcgg ggcggggcgg

     3601 ggcgaggggc ggggcggggc gaggcggaaa ggtgcggcgg cagccaatca gagcggcgcg

     3661 ctccgaaagt ttccttttat ggcgaggcgg cggcggcggc ggccctataa aaagcgaagc

     3721 gcgcggcggg cgggagtcgt tgcgcgctgc cttccccccg tgccccgctc cgccgccgcc

     3781 tcgcgccgcc cgccccggct ctgactgacc gcgttactcc cacaggtgag cgggcgggac

     3841 ggcccttctc ctccgggctg taattagcgc ttggtttaat gacggcttgt ttcttttctg

     3901 tggctgcgtg aaagccttga ggggctccgg gagggccctt tgtgcggggg gagcggctcg

     3961 gggggtgcgt gcgtgtgtgt gtgcgtgggg agcgccgcgt gcggctccgc gctgcccggc

     4021 ggctgtgagc gctgcgggcg cggcgcgggg ctttgtgcgc tccgcagtgt gcgcgagggg

     4081 agcgcggccg ggggcggtgc cccgcggtgc ggggggggct gcgaggggaa caaaggctgc

     4141 gtgcggggtg tgtgcgtggg ggggtgagca gggggtgtgg gcgcgtcggt cgggctgcaa

     4201 ccccccctgc acccccctcc ccgagttgct gagcacggcc cggcttcggg tgcggggctc

     4261 cgtacggggc gtggcgcggg gctcgccgtg ccgggcgggg ggtggcggca ggtgggggtg

     4321 ccgggcgggg cggggccgcc tcgggccggg gagggctcgg gggaaggggc gcggcggccc

     4381 ccggagcgcc ggcggctgtc gaggcgcggc gagccgcagc cattgccttt tatggtaatc

     4441 gtgcgagagg gcgcagggac ttcctttgtc ccaaatctgt gcggagccga aatctgggag

     4501 gcgccgccgc accccctcta gcgggcgcgg ggcgaagcgg tgcggcgccg gcaggaagga

     4561 aatgggcggg gagggccttc gtgcgtcgcc gcgccgccgt ccccttctcc ctctccagcc

     4621 tcggggctgt ccgcgggggg acggctgcct tcggggggga cggggcaggg cggggttcgg

     4681 cttctggcgt gtgaccggcg gctctagagc ctctgctaac catgttcatg ccttcttctt

     4741 tttcctacag ctcctgggca acgtgctggt tattgtgctg tctcatcatt ttggcaaaga

     4801 a


Product is for research use only!

Search name

pCAGGS,Plasmid pCAGGS,pCAGGS vector

No customer comments for the moment.

Add A Comment

Related Products


No products

Total $0.00

Prices don't include postage.
