pCAGGS Plasmid


  • Model: PVT1020
  • 50 Units in Stock
Ask a question

Add to Cart:


Search name

pCAGGS,Plasmid pCAGGS,pCAGGS vector


pCAGGS Information

Promoter: CAG promoter

Replicator: SV40 ori, ori

Terminator: beta -globin poly (A) signal

Plasmid classification: lactation serial plasmid; lactation expression plasmid; pCAG series plasmid.

Plasmid size: 4801bp

Prokaryotic resistance: ampicillin Amp (100 u g/ml)

Cloned strains of Escherichia coli, DH5 A and other Escherichia coli

Culture conditions: 37 centigrade, aerobic, LB

Expression host: mammalian cells such as 293T

Culture conditions: 37 C, 5%CO2

Induction mode: no induction, instantaneous expression

5'sequencing primers: pcaggs-F (GTTCGGCTTCTGGCGTGT)

3'sequencing primers: pcaggs-R (TATGTCCTTCCGAGTGAGAG)


pCAGGS Description

pCAGGS plasmid can be used to express gene efficiently under the control of chicken b- actin, rabbit b- globulin heterozygous promoter (CAG), and human CMV-IE enhancer in various mammalian cells. The CAG promoter sequence is part of the chicken b- actin promoter, the first exon and the first intron (it seems to have strong enhanced subtype activity. " It is linked to the rabbit b- globin fragment, the 3'part of the second intron includes the branching point needed for normal splicing reaction and the 5' portion of the third exon.

This plasmid is useful for highly efficient expression of genes under the control of the AG promoter and the human CMV-IE enhancer in various mammalian cells.The AG promoter sequence consists of the chicken β-actin promoter, the first exon and part of the first intron (that seems to have a strong enhancer-like activity) linked to a rabbit β-globin fragment, consisting of a 3' part of the second intron (inclusive a branch point which is required for normal splicing reactions) and a 5' part of the third exon.When cloning a fragment downstream from the lac promoter it may be advisable to use lacIq strains in order to prevent fortuitous expression of a possibly noxious polypeptide.



pCAGGS Sequence

LOCUS       Exported                4801 bp ds-DNA     circular SYN 18-MAY-2017
DEFINITION  synthetic circular DNA
SOURCE      synthetic DNA construct
  ORGANISM  synthetic DNA construct
REFERENCE   1  (bases 1 to 4801)
  TITLE     Direct Submission
  JOURNAL   Exported Thursday, May 18, 2017  
FEATURES             Location/Qualifiers
     source          1..4801
                     /organism="synthetic DNA construct"
                     /mol_type="other DNA"
     polyA_site      158..213
                     /note="beta-globin poly(A) signal"
                     /note="rabbit beta-globin polyadenylation signal"
     primer_bind     complement(574..590)
                     /note="M13 rev"
                     /note="common sequencing primer, one of multiple similar 
     protein_bind    598..614
                     /bound_moiety="lac repressor encoded by lacI"
                     /note="lac operator"
                     /note="The lac repressor binds to the lac operator to 
                     inhibit transcription in E. coli. This inhibition can be 
                     relieved by adding lactose or 
                     isopropyl-beta-D-thiogalactopyranoside (IPTG)."
     promoter        complement(622..652)
                     /note="lac promoter"
                     /note="promoter for the E. coli lac operon"
     protein_bind    666..687
                     /bound_moiety="E. coli catabolite activator protein"
                     /note="CAP binding site"
                     /note="CAP binding activates transcription in the presence 
                     of cAMP."
     promoter        746..941
                     /note="SV40 promoter"
                     /note="SV40 early promoter"
     rep_origin      792..927
                     /note="SV40 ori"
                     /note="SV40 origin of replication"
     polyA_signal    947..1081
                     /note="SV40 poly(A) signal"
                     /note="SV40 polyadenylation signal"
     rep_origin      complement(1319..1907)
                     /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of 
     CDS             complement(2078..2938)
                     /note="confers resistance to ampicillin, carbenicillin, and
                     related antibiotics"
     promoter        complement(2939..3043)
                     /note="AmpR promoter"
     enhancer        3074..3453
                     /note="CMV enhancer"
                     /note="human cytomegalovirus immediate early enhancer"
     promoter        3455..3732
                     /note="chicken beta-actin promoter"
     intron          3733..4750
                     /note="chimeric intron"
                     /note="chimera between introns from chicken beta-actin and 
                     rabbit beta-globin"
        1 ttcctcgagg aattcactcc tcaggtgcag gctgcctatc agaaggtggt ggctggtgtg
       61 gccaatgccc tggctcacaa ataccactga gatctttttc cctctgccaa aaattatggg
      121 gacatcatga agccccttga gcatctgact tctggctaat aaaggaaatt tattttcatt
      181 gcaatagtgt gttggaattt tttgtgtctc tcactcggaa ggacatatgg gagggcaaat
      241 catttaaaac atcagaatga gtatttggtt tagagtttgg caacatatgc ccatatgctg
      301 gctgccatga acaaaggttg gctataaaga ggtcatcagt atatgaaaca gccccctgct
      361 gtccattcct tattccatag aaaagccttg acttgaggtt agattttttt tatattttgt
      421 tttgtgttat ttttttcttt aacatcccta aaattttcct tacatgtttt actagccaga
      481 tttttcctcc tctcctgact actcccagtc atagctgtcc ctcttctctt atggagatcc
      541 ctcgacctgc agcccaagct tggcgtaatc atggtcatag ctgtttcctg tgtgaaattg
      601 ttatccgctc acaattccac acaacatacg agccggaagc ataaagtgta aagcctgggt
      661 gcctaatgag tgagctaact cacattaatt gcgttgcgct cactgcccgc tttccagtcg
      721 ggaaacctgt cgtgccagcg gatccgcatc tcaattagtc agcaaccata gtcccgcccc
      781 taactccgcc catcccgccc ctaactccgc ccagttccgc ccattctccg ccccatggct
      841 gactaatttt ttttatttat gcagaggccg aggccgcctc ggcctctgag ctattccaga
      901 agtagtgagg aggctttttt ggaggcctag gcttttgcaa aaagctaact tgtttattgc
      961 agcttataat ggttacaaat aaagcaatag catcacaaat ttcacaaata aagcattttt
     1021 ttcactgcat tctagttgtg gtttgtccaa actcatcaat gtatcttatc atgtctggat
     1081 ccgctgcatt aatgaatcgg ccaacgcgcg gggagaggcg gtttgcgtat tgggcgctct
     1141 tccgcttcct cgctcactga ctcgctgcgc tcggtcgttc ggctgcggcg agcggtatca
     1201 gctcactcaa aggcggtaat acggttatcc acagaatcag ggataacgca ggaaagaaca
     1261 tgtgagcaaa aggccagcaa aaggccagga accgtaaaaa ggccgcgttg ctggcgtttt
     1321 tccataggct ccgcccccct gacgagcatc acaaaaatcg acgctcaagt cagaggtggc
     1381 gaaacccgac aggactataa agataccagg cgtttccccc tggaagctcc ctcgtgcgct
     1441 ctcctgttcc gaccctgccg cttaccggat acctgtccgc ctttctccct tcgggaagcg
     1501 tggcgctttc tcatagctca cgctgtaggt atctcagttc ggtgtaggtc gttcgctcca
     1561 agctgggctg tgtgcacgaa ccccccgttc agcccgaccg ctgcgcct
No customer comments for the moment.

Add A Comment

Related Products


No products

Total $0.00

Prices don't include postage.
