pCAMBIA1381 Plasmid


  • Model: PVT3018
  • 50 Units in Stock
Ask a question

Add to Cart:


Search name

pCAMBIA1381,Plasmid pCAMBIA1381,pCAMBIA1381 vector


pCAMBIA1381 Information

Promoter: CaMV 35S

Replicator: pVS1 oriV, ori

Terminator: NOS

Plasmid classification: plant series, protein overexpression vector

Plasmid size: 10657bp

Prokaryotic resistance: Kan

Screening markers: HygR

Cloned strain: DH5 alpha

Culture conditions: 37 centigrade, aerobic LB

Expression host: plant cells

5'sequencing primers: 35S:GACGCACAATCCCACTATCC

3'sequencing primers: primers designed according to sequence



pCAMBIA1381 Description



pCAMBIA1381 Sequence

LOCUS       Exported               10657 bp ds-DNA     circular SYN 14-SEP-2016
DEFINITION  synthetic circular DNA
KEYWORDS    Untitled 5
SOURCE      synthetic DNA construct
  ORGANISM  synthetic DNA construct
REFERENCE   1  (bases 1 to 10657)
  TITLE     Direct Submission
  JOURNAL   Exported Wednesday, September 14, 2016 from SnapGene Viewer 3.2.1
FEATURES             Location/Qualifiers
     source          1..10657
                     /organism="synthetic DNA construct"
                     /mol_type="other DNA"
     CDS             20..1825
                     /gene="uidA (or gusA) from E. coli"
     CDS             1832..1849
                     /product="6xHis affinity tag"
     terminator      1881..2133
                     /note="NOS terminator"
                     /note="nopaline synthase terminator and poly(A) signal"
     misc_feature    2155..2179
                     /note="RB T-DNA repeat"
                     /note="right border repeat from nopaline C58 T-DNA"
     CDS             3479..4108
                     /product="stability protein from the Pseudomonas plasmid 
                     pVS1 (Heeb et al., 2000)"
                     /note="pVS1 StaA"
     CDS             4542..5609
                     /product="replication protein from the Pseudomonas plasmid 
                     pVS1 (Heeb et al., 2000)"
                     /note="pVS1 RepA"
     rep_origin      5675..5869
                     /note="pVS1 oriV"
                     /note="origin of replication for the Pseudomonas plasmid 
                     pVS1 (Heeb et al., 2000)"
     misc_feature    6213..6353
                     /note="basis of mobility region from pBR322"
     rep_origin      complement(6539..7127)
                     /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of 
     CDS             complement(7214..8008)
                     /product="aminoglycoside phosphotransferase"
                     /note="confers resistance to kanamycin"
     misc_feature    8433..8457
                     /note="LB T-DNA repeat"
                     /note="left border repeat from nopaline C58 T-DNA"
     polyA_signal    8535..8709
                     /note="CaMV poly(A) signal"
                     /note="cauliflower mosaic virus polyadenylation signal"
     CDS             complement(8749..9774)
                     /product="aminoglycoside phosphotransferase from E. coli"
                     /note="confers resistance to hygromycin"
No customer comments for the moment.

Add A Comment

Related Products


No products

Total $0.00

Prices don't include postage.
