pCambia1381Xc

$356.00

  • Model: PVTH0004
  • 50 Units in Stock
Ask a question


Add to Cart:

pCambia1381Xc

Alternative name

pCambia1381Xc,pCambia1381Xc vector, pCambia1381Xc plasmid, pCambia1381Xc map

 

pCambia1381Xc Information

Vector Name : pCambia1381Xc, pCambia 1381Xc vector

Plasmid type: plant expression vector

High copy / low copy: low copy

Promoter: CAMV35S

Cloning methods: polyclonal sites, restrictive endonucleases

Carrier size: 10648 BP

5'sequencing primers and sequences: 35S promoter: CTATCCTTCGCAAGACCCTTC

3'sequencing primers and sequences: --

Carrier label: GusA

Carrier resistance: kanana and Hygromycin

Screening markers: HPTII

Note: -

Stability: stable expression

Composition type: non group molding

Virus / non virus: non virus

 

pCambia1381Xc Description 

PCambia1381Xc is a plant expression vector.

 

pCambia1381Xc Sequence

 

  LOCUS       pCAMBIA1381Xc          10648 bp ds-DNA    circular SYN    DEFINITION  Agrobacterium binary vector with hygromycin- and               kanamycin-resistance and GUS genes plus the pUC8 MCS. For other               reading frames, use pCAMBIA1381Xa or pCAMBIA1381Xb.  ACCESSION   AF234305  VERSION     .  KEYWORDS    pCAMBIA1381Xc  SOURCE      synthetic DNA construct    ORGANISM  synthetic DNA construct  COMMENT     This file is created by Vector NTI  COMMENT     The GenBank record was corrected by inserting a G at position 4541.  FEATURES             Location/Qualifiers       source          1..10648                       /organism="synthetic DNA construct"                       /lab_host="Plant Cells"                       /mol_type="other DNA"       CDS             20..1825                       /codon_start=1                       /gene="uidA?(or gusA)?from E. coli"                       /product="beta-glucuronidase"                       /label="GUS"       CDS             1832..1849                       /codon_start=1                       /product="6xHis affinity tag"                       /label="6xHis"                       /translation="HHHHHH"       terminator      1881..2133                       /label="NOS terminator"                       /label="nopaline synthase terminator and poly(A) signal"       misc_feature    2155..2179                       /label="RB T-DNA repeat"                       /label="right border repeat from nopaline C58 T-DNA"       CDS             3479..4108                       /codon_start=1                       /product="stability protein from Pseudomonas plasmid pVS1"                       /label="pVS1 StaA"       CDS             4537..5610                       /codon_start=1                       /product="replication protein from Pseudomonas plasmid                        pVS1"                       /label="pVS1 RepA"                       /label="                       "                       /protein_id="                       "       misc_feature    6214..6354                       /label="bom"                       /label="basis of mobility region from pBR322"       rep_origin      complement(6540..7128)                       /direction=LEFT                       /label="ori"                       /label="high-copy-number ColE1/pMB1/pBR322/pUC origin of                        replication"       CDS             complement(7215..8009)                       /codon_start=1                       /gene="aphA-3"                       /product="aminoglycoside phosphotransferase"                       /label="KanR"                       /label="confers resistance to kanamycin"                       /protein_id="                       "       misc_feature    8434..8458                       /label="LB T-DNA repeat"                       /label="left border repeat from nopaline C58 T-DNA"       polyA_signal    8536..8710                       /label="CaMV poly(A) signal"                       /label="cauliflower mosaic virus polyadenylation signal"       CDS             complement(8750..9775)                       /codon_start=1                       /product="hygromycin B phosphotransferase"                       /label="HygR"                       /label="confers resistance to hygromycin"       promoter        complement(9843..10520)                       /label="CaMV 35S promoter (enhanced)"                       /label="cauliflower mosaic virus 35S promoter with a                        duplicated enhancer region"       misc_feature    10609..10644                       /label="MCS"                       /label="multiple cloning site from pUC8"  ORIGIN          1 cgctgtagat ctgactagtt tacgtcctgt agaaacccca acccgtgaaa tcaaaaaact         61 cgacggcctg tgggcattca gtctggatcg cgaaaactgt ggaattgatc agcgttggtg        121 ggaaagcgcg ttacaagaaa gccgggcaat tgctgtgcca ggcagtttta acgatcagtt        181 cgccgatgca gatattcgta attatgcggg caacgtctgg tatcagcgcg aagtctttat        241 accgaaaggt tgggcaggcc agcgtatcgt gctgcgtttc gatgcggtca ctcattacgg        301 caaagtgtgg gtcaataatc aggaagtgat ggagcatcag ggcggctata cgccatttga        361 agccgatgtc acgccgtatg ttattgccgg gaaaagtgta cgtatcaccg tttgtgtgaa        421 caacgaactg aactggcaga ctatcccgcc gggaatggtg attaccgacg aaaacggcaa        481 gaaaaagcag tcttacttcc atgatttctt taactatgcc ggaatccatc gcagcgtaat        541 gctctacacc acgccgaaca cctgggtgga cgatatcacc gtggtgacgc atgtcgcgca        601 agactgtaac cacgcgtctg ttgactggca ggtggtggcc aatggtgatg tcagcgttga        661 actgcgtgat gcggatcaac aggtggttgc aactggacaa ggcactagcg ggactttgca        721 agtggtgaat ccgcacctct ggcaaccggg tgaaggttat ctctatgaac tgtgcgtcac        781 agccaaaagc cagacagagt gtgatatcta cccgcttcgc gtcggcatcc ggtcagtggc        841 agtgaagggc caacagttcc tgattaacca caaaccgttc tactttactg gctttggtcg        901 tcatgaagat gcggacttac gtggcaaagg attcgataac gtgctgatgg tgcacgacca        961 cgcattaatg gactggattg gggccaactc ctaccgtacc tcgcattacc cttacgctga       1021 agagatgctc gactgggcag atgaacatgg catcgtggtg attgatgaaa ctgctgctgt       1081 cggctttcag ctgtctttag gcattggttt cgaagcgggc aacaagccga aagaactgta       1141 cagcgaagag gcagtcaacg gggaaactca gcaagcgcac ttacaggcga ttaaagagct       1201 gatagcgcgt gacaaaaacc acccaagcgt ggtgatgtgg agtattgcca acgaaccgga       1261 tacccgtccg caaggtgcac gggaatattt cgcgccactg gcggaagcaa cgcgtaaact       1321 cgacccgacg cgtccgatca cctgcgtcaa tgtaatgttc tgcgacgctc acaccgatac       1381 catcagcgat ctctttgatg tgctgtgcct gaaccgttat tacggatggt atgtccaaag       1441 cggcgatttg gaaacggcag agaaggtact ggaaaaagaa cttctggcct ggcaggagaa       1501 actgcatcag ccgattatca tcaccgaata cggcgtggat acgttagccg ggctgcactc       1561 aatgtacacc gacatgtgga gtgaagagta tcagtgtgca tggctggata tgtatcaccg       1621 cgtctttgat cgcgtcagcg ccgtcgtcgg tgaacaggta tggaatttcg ccgattttgc       1681 gacctcgcaa ggcatattgc gcgttggcgg taacaagaaa gggatcttca ctcgcgaccg       1741 caaaccgaag tcggcggctt ttctgctgca aaaacgctgg actggcatga acttcggtga       1801 aaaaccgcag cagggaggca aacaagctag ccaccaccac caccaccacg tgtgaattgg       1861 tgaccagctc gaatttcccc gatcgttcaa acatttggca ataaagtttc ttaagattga       1921 atcctgttgc cggtcttgcg atgattatca tataatttct gttgaattac gttaagcatg       1981 taataattaa catgtaatgc atgacgttat ttatgagatg ggtttttatg attagagtcc       2041 cgcaattata catttaatac gcgatagaaa acaaaatata gcgcgcaaac taggataaat       2101 tatcgcgcgc ggtgtcatct atgttactag atcgggaatt aaactatcag tgtttgacag       2161 gatatattgg cgggtaaacc taagagaaaa gagcgtttat tagaataacg gatatttaaa       2221 agggcgtgaa aaggtttatc cgttcgtcca tttgtatgtg catgccaacc acagggttcc       2281 cctcgggatc aaagtacttt gatccaaccc ctccgctgct atagtgcagt cggcttctga       2341 cgttcagtgc agccgtcttc tgaaaacgac atgtcgcaca agtcctaagt tacgcgacag       2401 gctgccgccc tgcccttttc ctggcgtttt cttgtcgcgt gttttagtcg cataaagtag       2461 aatacttgcg actagaaccg gagacattac gccatgaaca agagcgccgc cgctggcctg       2521 ctgggctatg cccgcgtcag caccgacgac caggacttga ccaaccaacg ggccgaactg       2581 cacgcggccg gctgcaccaa gctgttttcc gagaagatca ccggcaccag gcgcgaccgc       2641 ccggagctgg ccaggatgct tgaccaccta cgccctggcg acgttgtgac agtgaccagg       2701 ctagaccgcc tggcccgcag cacccgcgac ctactggaca ttgccgagcg catccaggag       2761 gccggcgcgg gcctgcgtag cctggcagag ccgtgggccg acaccaccac gccggccggc       2821 cgcatggtgt tgaccgtgtt cgccggcatt gccgagttcg agcgttccct aatcatcgac       2881 cgcacccgga gcgggcgcga ggccgccaag gcccgaggcg tgaagtttgg cccccgccct       2941 accctcaccc cggcacagat cgcgcacgcc cgcgagctga tcgaccagga aggccgcacc       3001 gtgaaagagg cggctgcact gcttggcgtg catcgctcga ccctgtaccg cgcacttgag       3061 cgcagcgagg aagtgacgcc caccgaggcc aggcggcgcg gtgccttccg tgaggacgca       3121 ttgaccgagg ccgacgccct ggcggccgcc gagaatgaac gccaagagga acaagcatga       3181 aaccgcacca ggacggccag gacgaaccgt ttttcattac cgaagagatc gaggcggaga       3241 tgatcgcggc cgggtacgtg ttcgagccgc ccgcgcacgt ctcaaccgtg cggctgcatg       3301 aaatcctggc cggtttgtct gatgccaagc tggcggcctg gccggccagc ttggccgctg       3361 aagaaaccga gcgccgccgt ctaaaaaggt gatgtgtatt tgagtaaaac agcttgcgtc       3421 atgcggtcgc tgcgtatatg atgcgatgag taaataaaca aatacgcaag gggaacgcat       3481 gaaggttatc gctgtactta accagaaagg cgggtcaggc aagacgacca tcgcaaccca       3541 tctagcccgc gccctgcaac tcgccggggc cgatgttctg ttagtcgatt ccgatcccca       3601 gggcagtgcc cgcgattggg cggccgtgcg ggaagatcaa ccgctaaccg ttgtcggcat       3661 cgaccgcccg acgattgacc gcgacgtgaa ggccatcggc cggcgcgact tcgtagtgat       3721 cgacggagcg ccccaggcgg cggacttggc tgtgtccgcg atcaaggcag ccgacttcgt       3781 gctgattccg gtgcagccaa gcccttacga catatgggcc accgccgacc tggtggagct       3841 ggttaagcag cgcattgagg tcacggatgg aaggctacaa gcggcctttg tcgtgtcgcg       3901 ggcgatcaaa ggcacgcgca tcggcggtga ggttgccgag gcgctggccg ggtacgagct       3961 gcccattctt gagtcccgta tcacgcagcg cgtgagctac ccaggcactg ccgccgccgg       4021 cacaaccgtt cttgaatcag aacccgaggg cgacgctgcc cgcgaggtcc aggcgctggc       4081 cgctgaaatt aaatcaaaac tcatttgagt taatgaggta aagagaaaat gagcaaaagc       4141 acaaacacgc taagtgccgg ccgtccgagc gcacgcagca gcaaggctgc aacgttggcc       4201 agcctggcag acacgccagc catgaagcgg gtcaactttc agttgccggc ggaggatcac       4261 accaagctga agatgtacgc ggtacgccaa ggcaagacca ttaccgagct gctatctgaa       4321 tacatcgcgc agctaccaga gtaaatgagc aaatgaataa atgagtagat gaattttagc       4381 ggctaaagga ggcggcatgg aaaatcaaga acaaccaggc accgacgccg tggaatgccc       4441 catgtgtgga ggaacgggcg gttggccagg cgtaagcggc tgggttgtct gccggccctg       4501 caatggcact ggaaccccca agcccgagga atcggcgtga gcggtcgcaa accatccggc       4561 ccggtacaaa tcggcgcggc gctgggtgat gacctggtgg agaagttgaa ggccgcgcag       4621 gccgcccagc ggcaacgcat cgaggcagaa gcacgccccg gtgaatcgtg gcaagcggcc       4681 gctgatcgaa tccgcaaaga atcccggcaa ccgccggcag ccggtgcgcc gtcgattagg       4741 aagccgccca agggcgacga gcaaccagat tttttcgttc cgatgctcta tgacgtgggc       4801 acccgcgata gtcgcagcat catggacgtg gccgttttcc gtctgtcgaa gcgtgaccga       4861 cgagctggcg aggtgatccg ctacgagctt ccagacgggc acgtagaggt ttccgcaggg       4921 ccggccggca tggccagtgt gtgggattac gacctggtac tgatggcggt ttcccatcta       4981 accgaatcca tgaaccgata ccgggaaggg aagggagaca agcccggccg cgtgttccgt       5041 ccacacgttg cggacgtact caagttctgc cggcgagccg atggcggaaa gcagaaagac       5101 gacctggtag aaacctgcat tcggttaaac accacgcacg ttgccatgca gcgtacgaag       5161 aaggccaaga acggccgcct ggtgacggta tccgagggtg aagccttgat tagccgctac       5221 aagatcgtaa agagcgaaac cgggcggccg gagtacatcg agatcgagct agctgattgg       5281 atgtaccgcg agatcacaga aggcaagaac ccggacgtgc tgacggttca ccccgattac       5341 tttttgatcg atcccggcat cggccgtttt ctctaccgcc tggcacgccg cgccgcaggc       5401 aaggcagaag ccagatggtt gttcaagacg atctacgaac gcagtggcag cgccggagag       5461 ttcaagaagt tctgtttcac cgtgcgcaag ctgatcgggt caaatgacct gccggagtac       5521 gatttgaagg aggaggcggg gcaggctggc ccgatcctag tcatgcgcta ccgcaacctg       5581 atcgagggcg aagcatccgc cggttcctaa tgtacggagc agatgctagg gcaaattgcc       5641 ctagcagggg aaaaaggtcg aaaaggtctc tttcctgtgg atagcacgta cattgggaac       5701 ccaaagccgt acattgggaa ccggaacccg tacattggga acccaaagcc gtacattggg       5761 aaccggtcac acatgtaagt gactgatata aaagagaaaa aaggcgattt ttccgcctaa       5821 aactctttaa aacttattaa aactcttaaa acccgcctgg cctgtgcata actgtctggc       5881 cagcgcacag ccgaagagct gcaaaaagcg cctacccttc ggtcgctgcg ctccctacgc       5941 cccgccgctt cgcgtcggcc tatcgcggcc gctggccgct caaaaatggc tggcctacgg       6001 ccaggcaatc taccagggcg cggacaagcc gcgccgtcgc cactcgaccg ccggcgccca       6061 catcaaggca ccctgcctcg cgcgtttcgg tgatgacggt gaaaacctct gacacatgca       6121 gctcccggag acggtcacag cttgtctgta agcggatgcc gggagcagac aagcccgtca       6181 gggcgcgtca gcgggtgttg gcgggtgtcg gggcgcagcc atgacccagt cacgtagcga       6241 tagcggagtg tatactggct taactatgcg gcatcagagc agattgtact gagagtgcac       6301 catatgcggt gtgaaatacc gcacagatgc gtaaggagaa aataccgcat caggcgctct       6361 tccgcttcct cgctcactga ctcgctgcgc tcggtcgttc ggctgcggcg agcggtatca       6421 gctcactcaa aggcggtaat acggttatcc acagaatcag gggataacgc aggaaagaac       6481 atgtgagcaa aaggccagca aaaggccagg aaccgtaaaa aggccgcgtt gctggcgttt       6541 ttccataggc tccgcccccc tgacgagcat cacaaaaatc gacgctcaag tcagaggtgg       6601 cgaaacccga caggactata aagataccag gcgtttcccc ctggaagctc cctcgtgcgc       6661 tctcctgttc cgaccctgcc gcttaccgga tacctgtccg cctttctccc ttcgggaagc       6721 gtggcgcttt ctcatagctc acgctgtagg tatctcagtt cggtgtaggt cgttcgctcc       6781 aagctgggct gtgtgcacga accccccgtt cagcccgacc gctgcgcctt atccggtaac       6841 tatcgtcttg agtccaaccc ggtaagacac gacttatcgc cactggcagc agccactggt       6901 aacaggatta gcagagcgag gtatgtaggc ggtgctacag agttcttgaa gtggtggcct       6961 aactacggct acactagaag gacagtattt ggtatctgcg ctctgctgaa gccagttacc       7021 ttcggaaaaa gagttggtag ctcttgatcc ggcaaacaaa ccaccgctgg tagcggtggt       7081 ttttttgttt gcaagcagca gattacgcgc agaaaaaaag gatctcaaga agatcctttg       7141 atcttttcta cggggtctga cgctcagtgg aacgaaaact cacgttaagg gattttggtc       7201 atgcattcta ggtactaaaa caattcatcc agtaaaatat aatattttat tttctcccaa       7261 tcaggcttga tccccagtaa gtcaaaaaat agctcgacat actgttcttc cccgatatcc       7321 tccctgatcg accggacgca gaaggcaatg tcataccact tgtccgccct gccgcttctc       7381 ccaagatcaa taaagccact tactttgcca tctttcacaa agatgttgct gtctcccagg       7441 tcgccgtggg aaaagacaag ttcctcttcg ggcttttccg tctttaaaaa atcatacagc       7501 tcgcgcggat ctttaaatgg agtgtcttct tcccagtttt cgcaatccac atcggccaga       7561 tcgttattca gtaagtaatc caattcggct aagcggctgt ctaagctatt cgtataggga       7621 caatccgata tgtcgatgga gtgaaagagc ctgatgcact ccgcatacag ctcgataatc       7681 ttttcagggc tttgttcatc ttcatactct tccgagcaaa ggacgccatc ggcctcactc       7741 atgagcagat tgctccagcc atcatgccgt tcaaagtgca ggacctttgg aacaggcagc       7801 tttccttcca gccatagcat catgtccttt tcccgttcca catcataggt ggtcccttta       7861 taccggctgt ccgtcatttt taaatatagg ttttcatttt ctcccaccag cttatatacc       7921 ttagcaggag acattccttc cgtatctttt acgcagcggt atttttcgat cagttttttc       7981 aattccggtg atattctcat tttagccatt tattatttcc ttcctctttt ctacagtatt       8041 taaagatacc ccaagaagct aattataaca agacgaactc caattcactg ttccttgcat       8101 tctaaaacct taaataccag aaaacagctt tttcaaagtt gttttcaaag ttggcgtata       8161 acatagtatc gacggagccg attttgaaac cgcggtgatc acaggcagca acgctctgtc       8221 atcgttacaa tcaacatgct accctccgcg agatcatccg tgtttcaaac ccggcagctt       8281 agttgccgtt cttccgaata gcatcggtaa catgagcaaa gtctgccgcc ttacaacggc       8341 tctcccgctg acgccgtccc ggactgatgg gctgcctgta tcgagtggtg attttgtgcc       8401 gagctgccgg tcggggagct gttggctggc tggtggcagg atatattgtg gtgtaaacaa       8461 attgacgctt agacaactta ataacacatt gcggacgttt ttaatgtact gaattaacgc       8521 cgaattaatt cgggggatct ggattttagt actggatttt ggttttagga attagaaatt       8581 ttattgatag aagtatttta caaatacaaa tacatactaa gggtttctta tatgctcaac       8641 acatgagcga aaccctatag gaaccctaat tcccttatct gggaactact cacacattat       8701 tatggagaaa ctcgagcttg tcgatcgaca gatccggtcg gcatctactc tatttctttg       8761 ccctcggacg agtgctgggg cgtcggtttc cactatcggc gagtacttct acacagccat       8821 cggtcc
No customer comments for the moment.

Add A Comment

Related Products

Cart  

No products

Total $0.00

Prices don't include postage.

Cart