pCAMBIA2300 Plasmid


  • Model: PVT3020
  • 50 Units in Stock
Ask a question

Add to Cart:

pCAMBIA2300 Plasmid

PVT3020    2ug


pCAMBIA2300 Plasmid Informaiton

Promoter: Lac, CaMV 35S

Replicon: pVS1 oriV, ori

Plasmid classification: plant series, protein overexpression vector

Plasmid size: 8743bp

Prokaryotic resistance: Kan

Selection marker: Neo

Clonal strain: DH5 alpha

Culture conditions: 37 C, aerobic LB

Expression host: plant cells

5'sequencing primers: 35S:GACGCACAATCCCACTATCC

Primers for 3'sequencing: primers designed based on sequences

Use: Plant expression


pCAMBIA2300 Description

The pCambia2300 vector offers: 1.High copy number in E.coli for high DNA yields 2. pVS1 replicon for high stability in Agrobacterium3.Small size 4.Restriction sites designed for modular plasmid modifications and small but adequate poly-linkers for introducing your DNA of interest 5. Bacterial selection with kanamycin


pCAMBIA2300 Multiple cloning site



pCAMBIA2300 Sequence

LOCUS       Exported                8743 bp ds-DNA     circular SYN 11-JAN-2016

DEFINITION  Agrobacterium binary vector for plant transformation, with 

            kanamycin-resistance genes.




SOURCE      synthetic DNA construct

  ORGANISM  synthetic DNA construct

REFERENCE   1  (bases 1 to 8743)

  AUTHORS   Cambia

  TITLE     Direct Submission

  JOURNAL   Exported Wednesday, September 14, 2016 from SnapGene Viewer 3.2.1

COMMENT     The GenBank record was corrected by inserting a G at position 2281.

FEATURES             Location/Qualifiers

     source          1..8743

                     /organism="synthetic DNA construct"

                     /lab_host="Plant Cells"

                     /mol_type="other DNA"

     CDS             1219..1848


                     /product="stability protein from Pseudomonas plasmid pVS1"

                     /note="pVS1 StaA"





     CDS             2277..3350


                     /product="replication protein from Pseudomonas plasmid 


                     /note="pVS1 RepA"








     rep_origin      3416..3610

                     /note="pVS1 oriV"

                     /note="origin of replication for the Pseudomonas plasmid 

                     pVS1 (Heeb et al., 2000)"

     misc_feature    3954..4094


                     /note="basis of mobility region from pBR322"

     rep_origin      complement(4280..4868)



                     /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of 


     CDS             complement(4955..5749)



                     /product="aminoglycoside phosphotransferase"


                     /note="confers resistance to kanamycin"






     misc_feature    6174..6198

                     /note="LB T-DNA repeat"

                     /note="left border repeat from nopaline C58 T-DNA"

     polyA_signal    6276..6450

                     /note="CaMV poly(A) signal"

                     /note="cauliflower mosaic virus polyadenylation signal"

     CDS             complement(6507..7304)


                     /gene="aph(3')-II (or nptII)"

                     /product="aminoglycoside phosphotransferase from Tn5"


                     /note="confers resistance to neomycin, kanamycin, and G418 







     promoter        complement(7367..8044)

                     /note="CaMV 35S promoter (enhanced)"

                     /note="cauliflower mosaic virus 35S promoter with a 

                     duplicated enhancer region"

     promoter        8271..8301

                     /note="lac promoter"

                     /note="promoter for the E. coli lac operon"

     protein_bind    8309..8325

                     /bound_moiety="lac repressor encoded by lacI"

                     /note="lac operator"

                     /note="The lac repressor binds to the lac operator to 

                     inhibit transcription in E. coli. This inhibition can be 

                     relieved by adding lactose or 

                     isopropyl-beta-D-thiogalactopyranoside (IPTG)."

     primer_bind     8333..8349

                     /note="M13 rev"

                     /note="common sequencing primer, one of multiple similar 


     CDS             8345..8578


                     /gene="lacZ (truncated)"

                     /product="LacZ-alpha fragment of beta-galactosidase"




     misc_feature    8359..8415


                     /note="pUC18/19 multiple cloning site"

     primer_bind     complement(8419..8435)

                     /note="M13 fwd"

                     /note="common sequencing primer, one of multiple similar 


     misc_feature    8638..8662

                     /note="RB T-DNA repeat"

                     /note="right border repeat from nopaline C58 T-DNA"


        1 catgccaacc acagggttcc cctcgggatc aaagtacttt gatccaaccc ctccgctgct

       61 atagtgcagt cggcttctga cgttcagtgc agccgtcttc tgaaaacgac atgtcgcaca

      121 agtcctaagt tacgcgacag gctgccgccc tgcccttttc ctggcgtttt cttgtcgcgt

      181 gttttagtcg cataaagtag aatacttgcg actagaaccg gagacattac gccatgaaca

      241 agagcgccgc cgctggcctg ctgggctatg cccgcgtcag caccgacgac caggacttga

      301 ccaaccaacg ggccgaactg cacgcggccg gctgcaccaa gctgttttcc gagaagatca

      361 ccggcaccag gcgcgaccgc ccggagctgg ccaggatgct tgaccaccta cgccctggcg

      421 acgttgtgac agtgaccagg ctagaccgcc tggcccgcag cacccgcgac ctactggaca

      481 ttgccgagcg catccaggag gccggcgcgg gcctgcgtag cctggcagag ccgtgggccg

      541 acaccaccac gccggccggc cgcatggtgt tgaccgtgtt cgccggcatt gccgagttcg

      601 agcgttccct aatcatcgac cgcacccgga gcgggcgcga ggccgccaag gcccgaggcg

      661 tgaagtttgg cccccgccct accctcaccc cggcacagat cgcgcacgcc cgcgagctga

      721 tcgaccagga aggccgcacc gtgaaagagg cggctgcact gcttggcgtg catcgctcga

      781 ccctgtaccg cgcacttgag cgcagcgagg aagtgacgcc caccgaggcc aggcggcgcg

      841 gtgccttccg tgaggacgca ttgaccgagg ccgacgccct ggcggccgcc gagaatgaac

      901 gccaagagga acaagcatga aaccgcacca ggacggccag gacgaaccgt ttttcattac

      961 cgaagagatc gaggcggaga tgatcgcggc cgggtacgtg ttcgagccgc ccgcgcacgt

     1021 ctcaaccgtg cggctgcatg aaatcctggc cggtttgtct gatgccaagc tggcggcctg

     1081 gccggccagc ttggccgctg aagaaaccga gcgccgccgt ctaaaaaggt gatgtgtatt

     1141 tgagtaaaac agcttgcgtc atgcggtcgc tgcgtatatg atgcgatgag taaataaaca

     1201 aatacgcaag gggaacgcat gaaggttatc gctgtactta accagaaagg cgggtcaggc

     1261 aagacgacca tcgcaaccca tctagcccgc gccctgcaac tcgccggggc cgatgttctg

     1321 ttagtcgatt ccgatcccca gggcagtgcc cgcgattggg cggccgtgcg ggaagatcaa

     1381 ccgctaaccg ttgtcggcat cgaccgcccg acgattgacc gcgacgtgaa ggccatcggc

     1441 cggcgcgact tcgtagtgat cgacggagcg ccccaggcgg cggacttggc tgtgtccgcg

     1501 atcaaggcag ccgacttcgt gctgattccg gtgcagccaa gcccttacga catatgggcc

     1561 accgccgacc tggtggagct ggttaagcag cgcattgagg tcacggatgg aaggctacaa

     1621 gcggcctttg tcgtgtcgcg ggcgatcaaa ggcacgcgca tcggcggtga ggttgccgag

     1681 gcgctggccg ggtacgagct gcccattctt gagtcccgta tcacgcagcg cgtgagctac

     1741 ccaggcactg ccgccgccgg cacaaccgtt cttgaatcag aacccgaggg cgacgctgcc

     1801 cgcgaggtcc aggcgctggc cgctgaaatt aaatcaaaac tcatttgagt taatgaggta

     1861 aagagaaaat gagcaaaagc acaaacacgc taagtgccgg ccgtccgagc gcacgcagca

     1921 gcaaggctgc aacgttggcc agcctggcag acacgccagc catgaagcgg gtcaactttc

     1981 agttgccggc ggaggatcac accaagctga agatgtacgc ggtacgccaa ggcaagacca

     2041 ttaccgagct gctatctgaa tacatcgcgc agctaccaga gtaaatgagc aaatgaataa

     2101 atgagtagat gaattttagc ggctaaagga ggcggcatgg aaaatcaaga acaaccaggc

     2161 accgacgccg tggaatgccc catgtgtgga ggaacgggcg gttggccagg cgtaagcggc

     2221 tgggttgtct gccggccctg caatggcact ggaaccccca agcccgagga atcggcgtga

     2281 gcggtcgcaa accatccggc ccggtacaaa tcggcgcggc gctgggtgat gacctggtgg

     2341 agaagttgaa ggccgcgcag gccgcccagc ggcaacgcat cgaggcagaa gcacgccccg

     2401 gtgaatcgtg gcaagcggcc gctgatcgaa tccgcaaaga atcccggcaa ccgccggcag

     2461 ccggtgcgcc gtcgattagg aagccgccca agggcgacga gcaaccagat tttttcgttc

     2521 cgatgctcta tgacgtgggc acccgcgata gtcgcagcat catggacgtg gccgttttcc

     2581 gtctgtcgaa gcgtgaccga cgagctggcg aggtgatccg ctacgagctt ccagacgggc

     2641 acgtagaggt ttccgcaggg ccggccggca tggccagtgt gtgggattac gacctggtac

     2701 tgatggcggt ttcccatcta accgaatcca tgaaccgata ccgggaaggg aagggagaca

     2761 agcccggccg cgtgttccgt ccacacgttg cggacgtact caagttctgc cggcgagccg

     2821 atggcggaaa gcagaaagac gacctggtag aaacctgcat tcggttaaac accacgcacg

     2881 ttgccatgca gcgtacgaag aaggccaaga acggccgcct ggtgacggta tccgagggtg

     2941 aagccttgat tagccgctac aagatcgtaa agagcgaaac cgggcggccg gagtacatcg

     3001 agatcgagct agctgattgg atgtaccgcg agatcacaga aggcaagaac ccggacgtgc

     3061 tgacggttca ccccgattac tttttgatcg atcccggcat cggccgtttt ctctaccgcc

     3121 tggcacgccg cgccgcaggc aaggcagaag ccagatggtt gttcaagacg atctacgaac

     3181 gcagtggcag cgccggagag ttcaagaagt tctgtttcac cgtgcgcaag ctgatcgggt

     3241 caaatgacct gccggagtac gatttgaagg aggaggcggg gcaggctggc ccgatcctag

     3301 tcatgcgcta ccgcaacctg atcgagggcg aagcatccgc cggttcctaa tgtacggagc

     3361 agatgctagg gcaaattgcc ctagcagggg aaaaaggtcg aaaaggtctc tttcctgtgg

     3421 atagcacgta cattgggaac ccaaagccgt acattgggaa ccggaacccg tacattggga

     3481 acccaaagcc gtacattggg aaccggtcac acatgtaagt gactgatata aaagagaaaa

     3541 aaggcgattt ttccgcctaa aactctttaa aacttattaa aactcttaaa acccgcctgg

     3601 cctgtgcata actgtctggc cagcgcacag ccgaagagct gcaaaaagcg cctacccttc

     3661 ggtcgctgcg ctccctacgc cccgccgctt cgcgtcggcc tatcgcggcc gctggccgct

     3721 caaaaatggc tggcctacgg ccaggcaatc taccagggcg cggacaagcc gcgccgtcgc

     3781 cactcgaccg ccggcgccca catcaaggca ccctgcctcg cgcgtttcgg tgatgacggt

     3841 gaaaacctct gacacatgca gctcccggag acggtcacag cttgtctgta agcggatgcc

     3901 gggagcagac aagcccgtca gggcgcgtca gcgggtgttg gcgggtgtcg gggcgcagcc

     3961 atgacccagt cacgtagcga tagcggagtg tatactggct taactatgcg gcatcagagc

     4021 agattgtact gagagtgcac catatgcggt gtgaaatacc gcacagatgc gtaaggagaa

     4081 aataccgcat caggcgctct tccgcttcct cgctcactga ctcgctgcgc tcggtcgttc

     4141 ggctgcggcg agcggtatca gctcactcaa aggcggtaat acggttatcc acagaatcag

     4201 gggataacgc aggaaagaac atgtgagcaa aaggccagca aaaggccagg aaccgtaaaa

     4261 aggccgcgtt gctggcgttt ttccataggc tccgcccccc tgacgagcat cacaaaaatc

     4321 gacgctcaag tcagaggtgg cgaaacccga caggactata aagataccag gcgtttcccc

     4381 ctggaagctc cctcgtgcgc tctcctgttc cgaccctgcc gcttaccgga tacctgtccg

     4441 cctttctccc ttcgggaagc gtggcgcttt ctcatagctc acgctgtagg tatctcagtt

     4501 cggtgtaggt cgttcgctcc aagctgggct gtgtgcacga accccccgtt cagcccgacc

     4561 gctgcgcctt atccggtaac tatcgtcttg agtccaaccc ggtaagacac gacttatcgc

     4621 cactggcagc agccactggt aacaggatta gcagagcgag gtatgtaggc ggtgctacag

     4681 agttcttgaa gtggtggcct aactacggct acactagaag gacagtattt ggtatctgcg

     4741 ctctgctgaa gccagttacc ttcggaaaaa gagttggtag ctcttgatcc ggcaaacaaa

     4801 ccaccgctgg tagcggtggt ttttttgttt gcaagcagca gattacgcgc agaaaaaaag

     4861 gatctcaaga agatcctttg atcttttcta cggggtctga cgctcagtgg aacgaaaact

     4921 cacgttaagg gattttggtc atgcattcta ggtactaaaa caattcatcc agtaaaatat

     4981 aatattttat tttctcccaa tcaggcttga tccccagtaa gtcaaaaaat agctcgacat

     5041 actgttcttc cccgatatcc tccctgatcg accggacgca gaaggcaatg tcataccact

     5101 tgtccgccct gccgcttctc ccaagatcaa taaagccact tactttgcca tctttcacaa

     5161 agatgttgct gtctcccagg tcgccgtggg aaaagacaag ttcctcttcg ggcttttccg

     5221 tctttaaaaa atcatacagc tcgcgcggat ctttaaatgg agtgtcttct tcccagtttt

     5281 cgcaatccac atcggccaga tcgttattca gtaagtaatc caattcggct aagcggctgt

     5341 ctaagctatt cgtataggga caatccgata tgtcgatgga gtgaaagagc ctgatgcact

     5401 ccgcatacag ctcgataatc ttttcagggc tttgttcatc ttcatactct tccgagcaaa

     5461 ggacgccatc ggcctcactc atgagcagat tgctccagcc atcatgccgt tcaaagtgca

     5521 ggacctttgg aacaggcagc tttccttcca gccatagcat catgtccttt tcccgttcca

     5581 catcataggt ggtcccttta taccggctgt ccgtcatttt taaatatagg ttttcatttt

     5641 ctcccaccag cttatatacc ttagcaggag acattccttc cgtatctttt acgcagcggt

     5701 atttttcgat cagttttttc aattccggtg atattctcat tttagccatt tattatttcc

     5761 ttcctctttt ctacagtatt taaagatacc ccaagaagct aattataaca agacgaactc

     5821 caattcactg ttccttgcat tctaaaacct taaataccag aaaacagctt tttcaaagtt

     5881 gttttcaaag ttggcgtata acatagtatc gacggagccg attttgaaac cgcggtgatc

     5941 acaggcagca acgctctgtc atcgttacaa tcaacatgct accctccgcg agatcatccg

     6001 tgtttcaaac ccggcagctt agttgccgtt cttccgaata gcatcggtaa catgagcaaa

     6061 gtctgccgcc ttacaacggc tctcccgctg acgccgtccc ggactgatgg gctgcctgta

     6121 tcgagtggtg attttgtgcc gagctgccgg tcggggagct gttggctggc tggtggcagg

     6181 atatattgtg gtgtaaacaa attgacgctt agacaactta ataacacatt gcggacgttt

     6241 ttaatgtact gaattaacgc cgaattaatt cgggggatct ggattttagt actggatttt

     6301 ggttttagga attagaaatt ttattgatag aagtatttta caaatacaaa tacatactaa

     6361 gggtttctta tatgctcaac acatgagcga aaccctatag gaaccctaat tcccttatct

     6421 gggaactact cacacattat tatggagaaa ctcgagcttg tcgatcgact ctagctagag

     6481 gatcgatccg aaccccagag tcccgctcag aagaactcgt caagaaggcg atagaaggcg

     6541 atgcgctgcg aatcgggagc ggcgataccg taaagcacga ggaagcggtc agcccattcg

     6601 ccgccaagct cttcagcaat atcacgggta gccaacgcta tgtcctgata gcggtccgcc

     6661 acacccagcc ggccacagtc gatgaatcca gaaaagcggc cattttccac catgatattc

     6721 ggcaagcagg catcgccatg tgtcacgacg agatcctcgc cgtcgggcat gcgcgccttg

     6781 agcctggcga acagttcggc tggcgcgagc ccctgatgct cttcgtccag atcatcctga

     6841 tcgacaagac cggcttccat ccgagtacgt gctcgctcga tgcgatgttt cgcttggtgg

     6901 tcgaatgggc aggtagccgg atcaagcgta tgcagccgcc gcattgcatc agccatgatg

     6961 gatactttct cggcaggagc aaggtgagat gacaggagat cctgccccgg cacttcgccc

     7021 aatagcagcc agtcccttcc cgcttcagtg acaacgtcga gcacagctgc gcaaggaacg

     7081 cccgtcgtgg ccagccacga tagccgcgct gcctcgtcct ggagttcatt cagggcaccg

     7141 gacaggtcgg tcttgacaaa aagaaccggg cgcccctgcg ctgacagccg gaacacggcg

     7201 gcatcagagc agccgattgt ctgttgtgcc cagtcatagc cgaatagcct ctccacccaa

     7261 gcggccggag aacctgcgtg caatccatct tgttcaatcc ccatggtcga tcgacagatc

     7321 tgcgaaagct cgagagagat agatttgtag agagagactg gtgatttcag cgtgtcctct

     7381 ccaaatgaaa tgaacttcct tatatagagg aaggtcttgc gaaggatagt gggattgtgc

     7441 gtcatccctt acgtcagtgg agatatcaca tcaatccact tgctttgaag acgtggttgg

     7501 aacgtcttct ttttccacga tgctcctcgt gggtgggggt ccatctttgg gaccactgtc

     7561 ggcagaggca tcttgaacga tagcctttcc tttatcgcaa tgatggcatt tgtaggtgcc

     7621 accttccttt tctactgtcc ttttgatgaa gtgacagata gctgggcaat ggaatccgag

     7681 gaggtttccc gatattaccc tttgttgaaa agtctcaata gccctttggt cttctgagac

     7741 tgtatctttg atattcttgg agtagacgag agtgtcgtgc tccaccatgt tatcacatca

     7801 atccacttgc tttgaagacg tggttggaac gtcttctttt tccacgatgc tcctcgtggg

     7861 tgggggtcca tctttgggac cactgtcggc agaggcatct tgaacgatag cctttccttt

     7921 atcgcaatga tggcatttgt aggtgccacc ttccttttct actgtccttt tgatgaagtg

     7981 acagatagct gggcaatgga atccgaggag gtttcccgat attacccttt gttgaaaagt

     8041 ctcaatagcc ctttggtctt ctgagactgt atctttgata ttcttggagt agacgagagt

     8101 gtcgtgctcc accatgttgg caagctgctc tagccaatac gcaaaccgcc tctccccgcg

     8161 cgttggccga ttcattaatg cagctggcac gacaggtttc ccgactggaa agcgggcagt

     8221 gagcgcaacg caattaatgt gagttagctc actcattagg caccccaggc tttacacttt

     8281 atgcttccgg ctcgtatgtt gtgtggaatt gtgagcggat aacaatttca cacaggaaac

     8341 agctatgacc atgattacga attcgagctc ggtacccggg gatcctctag agtcgacctg

     8401 caggcatgca agcttggcac tggccgtcgt tttacaacgt cgtgactggg aaaaccctgg

     8461 cgttacccaa cttaatcgcc ttgcagcaca tccccctttc gccagctggc gtaatagcga

     8521 agaggcccgc accgatcgcc cttcccaaca gttgcgcagc ctgaatggcg aatgctagag

     8581 cagcttgagc ttggatcaga ttgtcgtttc ccgccttcag tttaaactat cagtgtttga

     8641 caggatatat tggcgggtaa acctaagaga aaagagcgtt tattagaata acggatattt

     8701 aaaagggcgt gaaaaggttt atccgttcgt ccatttgtat gtg


Product is for research use only!


Search name
pCAMBIA2300,Plasmid pCAMBIA2300,pCAMBIA2300 vector

No customer comments for the moment.

Add A Comment

Related Products


No products

Total $0.00

Prices don't include postage.
