pCAMBIA2300 Plasmid


  • Model: PVT3020
  • 50 Units in Stock
Ask a question

Add to Cart:


Search name

pCAMBIA2300,Plasmid pCAMBIA2300,pCAMBIA2300 vector


pCAMBIA2300 Informaiton

Promoter: Lac, CaMV 35S

Replicon: pVS1 oriV, ori

Plasmid classification: plant series, protein overexpression vector

Plasmid size: 8743bp

Prokaryotic resistance: Kan

Selection marker: Neo

Clonal strain: DH5 alpha

Culture conditions: 37 C, aerobic LB

Expression host: plant cells

5'sequencing primers: 35S:GACGCACAATCCCACTATCC

Primers for 3'sequencing: primers designed based on sequences

Use: Plant expression


pCAMBIA2300 Description

The pCambia2300 vector offers: 1.High copy number in E.coli for high DNA yields 2. pVS1 replicon for high stability in Agrobacterium3.Small size 4.Restriction sites designed for modular plasmid modifications and small but adequate poly-linkers for introducing your DNA of interest 5. Bacterial selection with kanamycin


pCAMBIA2300 Multiple cloning site



pCAMBIA2300 Sequence

LOCUS       Exported                8743 bp ds-DNA     circular SYN 11-JAN-2016
DEFINITION  Agrobacterium binary vector for plant transformation, with 
            kanamycin-resistance genes.
SOURCE      synthetic DNA construct
  ORGANISM  synthetic DNA construct
REFERENCE   1  (bases 1 to 8743)
  AUTHORS   Cambia
  TITLE     Direct Submission
  JOURNAL   Exported Wednesday, September 14, 2016 from SnapGene Viewer 3.2.1
COMMENT     The GenBank record was corrected by inserting a G at position 2281.
FEATURES             Location/Qualifiers
     source          1..8743
                     /organism="synthetic DNA construct"
                     /lab_host="Plant Cells"
                     /mol_type="other DNA"
     CDS             1219..1848
                     /product="stability protein from Pseudomonas plasmid pVS1"
                     /note="pVS1 StaA"
     CDS             2277..3350
                     /product="replication protein from Pseudomonas plasmid 
                     /note="pVS1 RepA"
     rep_origin      3416..3610
                     /note="pVS1 oriV"
                     /note="origin of replication for the Pseudomonas plasmid 
                     pVS1 (Heeb et al., 2000)"
     misc_feature    3954..4094
                     /note="basis of mobility region from pBR322"
     rep_origin      complement(4280..4868)
                     /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of 
     CDS             complement(4955..5749)
                     /product="aminoglycoside phosphotransferase"
                     /note="confers resistance to kanamycin"
     misc_feature    6174..6198
                     /note="LB T-DNA repeat"
                     /note="left border repeat from nopaline C58 T-DNA"
     polyA_signal    6276..6450
                     /note="CaMV poly(A) signal"
                     /note="cauliflower mosaic virus polyadenylation signal"
     CDS             complement(6507..7304)
                     /gene="aph(3')-II (or nptII)"
                     /product="aminoglycoside phosphotransferase from Tn5"
                     /note="confers resistance to neomycin, kanamycin, and G418 
     promoter        complement(7367..8044)
                     /note="CaMV 35S promoter (enhanced)"
                     /note="cauliflower mosaic virus 35S promoter with a 
                     duplicated enhancer region"
     promoter        8271..8301
                     /note="lac promoter"
                     /note="promoter for the E. coli lac operon"
     protein_bind    8309..8325
                     /bound_moiety="lac repressor encoded by lacI"
                     /note="lac operator"
                     /note="The lac repressor binds to the lac operator to 
                     inhibit transcription in E. coli. This inhibition can be 
                     relieved by adding lactose or 
                     isopropyl-beta-D-thiogalactopyranoside (IPTG)."
     primer_bind     8333..8349
                     /note="M13 rev"
                     /note="common sequencing primer, one of multiple similar 
     CDS             8345..8578
                     /gene="lacZ (truncated)"
No customer comments for the moment.

Add A Comment

Related Products


No products

Total $0.00

Prices don't include postage.
