
  • Model: PVT3022
  • 50 Units in Stock
Ask a question

Add to Cart:


PVT3022      2ug


pCAMBIA3300 Information

Carrier name: pCAMBIA3300

Plasmid type: plant vector; Agrobacterium tumefaciens dual expression vector

High copy / low copy: high copy

Cloning method: restrictive endonuclease, polyclonal site

Promoter: Lac

Carrier size: 8429 BP

5'sequencing primers and sequences: M13 Reverse:CAGGAAACAGCTATGAC

3'sequencing primers and sequences: M13/pUC Forward:CCCAGTCACGACGTTGTAAAACG

Carrier label: -

Carrier resistance: kanamycin

Screening markers: butylphosphine (phosphonium) phosphinothricin

Cloned strain: HB101 and other strains

Host cells (lines): plant cells, Agrobacterium tumefaciens

Note: -

Product directory number: -

Stability: stable expression

Composition / inducible type: inducible type

Virus / non virus: non virus

Use: Plant expression



pCAMBIA3300 Description

pCAMBIA3300 is a Agrobacterium binary vector for plant transformation, with bialophos/phosphinothricin resistance and kanamycin resistance genes.


pCAMBIA3300 Sequence


LOCUS       Exported                8428 bp ds-DNA     circular SYN 14-SEP-2016

DEFINITION  synthetic circular DNA


SOURCE      synthetic DNA construct

  ORGANISM  synthetic DNA construct

REFERENCE   1  (bases 1 to 8428)


  TITLE     Direct Submission

FEATURES             Location/Qualifiers

     source          1..8428

                     /organism="synthetic DNA construct"

                     /mol_type="other DNA"

     promoter        complement(38..715)

                     /note="CaMV 35S promoter (enhanced)"

                     /note="cauliflower mosaic virus 35S promoter with a 

                     duplicated enhancer region"

     protein_bind    906..927

                     /bound_moiety="E. coli catabolite activator protein"

                     /note="CAP binding site"

                     /note="CAP binding activates transcription in the presence 

                     of cAMP."

     promoter        942..972

                     /note="lac promoter"

                     /note="promoter for the E. coli lac operon"

     protein_bind    980..996

                     /bound_moiety="lac repressor encoded by lacI"

                     /note="lac operator"

                     /note="The lac repressor binds to the lac operator to 

                     inhibit transcription in E. coli. This inhibition can be 

                     relieved by adding lactose or 

                     isopropyl-beta-D-thiogalactopyranoside (IPTG)."

     primer_bind     1004..1020

                     /note="M13 rev"

                     /note="common sequencing primer, one of multiple similar 


     CDS             1016..1249


                     /gene="lacZ fragment"

                     /product="LacZ-alpha fragment of beta-galactosidase"




     misc_feature    1030..1086


                     /note="pUC18/19 multiple cloning site"

     primer_bind     complement(1090..1106)

                     /note="M13 fwd"

                     /note="common sequencing primer, one of multiple similar 


     misc_feature    1309..1333

                     /note="RB T-DNA repeat"

                     /note="right border repeat from nopaline C58 T-DNA"

     CDS             2633..3262


                     /product="stability protein from Pseudomonas plasmid pVS1"

                     /note="pVS1 StaA"





     CDS             3696..4763


                     /product="replication protein from Pseudomonas plasmid 


                     /note="pVS1 RepA"








     misc_feature    5367..5507


                     /note="basis of mobility region from pBR322"

     rep_origin      complement(5693..6281)



                     /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of 


     CDS             complement(6368..7162)



                     /product="aminoglycoside phosphotransferase"


                     /note="confers resistance to kanamycin"






     misc_feature    7587..7611

                     /note="LB T-DNA repeat"

                     /note="left border repeat from nopaline C58 T-DNA"

     polyA_signal    7689..7863

                     /note="CaMV poly(A) signal"

                     /note="cauliflower mosaic virus polyadenylation signal"

     CDS             complement(7870..8421)


                     /gene="Streptomyces hygroscopicus bar"

                     /product="phosphinothricin acetyltransferase"


                     /note="confers resistance to bialophos or phosphinothricin"






        1 tcgagagaga tagatttgta gagagagact ggtgatttca gcgtgtcctc tccaaatgaa

       61 atgaacttcc ttatatagag gaaggtcttg cgaaggatag tgggattgtg cgtcatccct

      121 tacgtcagtg gagatatcac atcaatccac ttgctttgaa gacgtggttg gaacgtcttc

      181 tttttccacg atgctcctcg tgggtggggg tccatctttg ggaccactgt cggcagaggc

      241 atcttgaacg atagcctttc ctttatcgca atgatggcat ttgtaggtgc caccttcctt

      301 ttctactgtc cttttgatga agtgacagat agctgggcaa tggaatccga ggaggtttcc

      361 cgatattacc ctttgttgaa aagtctcaat agccctttgg tcttctgaga ctgtatcttt

      421 gatattcttg gagtagacga gagtgtcgtg ctccaccatg ttatcacatc aatccacttg

      481 ctttgaagac gtggttggaa cgtcttcttt ttccacgatg ctcctcgtgg gtgggggtcc

      541 atctttggga ccactgtcgg cagaggcatc ttgaacgata gcctttcctt tatcgcaatg

      601 atggcatttg taggtgccac cttccttttc tactgtcctt ttgatgaagt gacagatagc

      661 tgggcaatgg aatccgagga ggtttcccga tattaccctt tgttgaaaag tctcaatagc

      721 cctttggtct tctgagactg tatctttgat attcttggag tagacgagag tgtcgtgctc

      781 caccatgttg gcaagctgct ctagccaata cgcaaaccgc ctctccccgc gcgttggccg

      841 attcattaat gcagctggca cgacaggttt cccgactgga aagcgggcag tgagcgcaac

      901 gcaattaatg tgagttagct cactcattag gcaccccagg ctttacactt tatgcttccg

      961 gctcgtatgt tgtgtggaat tgtgagcgga taacaatttc acacaggaaa cagctatgac

     1021 catgattacg aattcgagct cggtacccgg ggatcctcta gagtcgacct gcaggcatgc

     1081 aagcttggca ctggccgtcg ttttacaacg tcgtgactgg gaaaaccctg gcgttaccca

     1141 acttaatcgc cttgcagcac atcccccttt cgccagctgg cgtaatagcg aagaggcccg

     1201 caccgatcgc ccttcccaac agttgcgcag cctgaatggc gaatgctaga gcagcttgag

     1261 cttggatcag attgtcgttt cccgccttca gtttaaacta tcagtgtttg acaggatata

     1321 ttggcgggta aacctaagag aaaagagcgt ttattagaat aacggatatt taaaagggcg

     1381 tgaaaaggtt tatccgttcg tccatttgta tgtgcatgcc aaccacaggg ttcccctcgg

     1441 gatcaaagta ctttgatcca acccctccgc tgctatagtg cagtcggctt ctgacgttca

     1501 gtgcagccgt cttctgaaaa cgacatgtcg cacaagtcct aagttacgcg acaggctgcc

     1561 gccctgccct tttcctggcg ttttcttgtc gcgtgtttta gtcgcataaa gtagaatact

     1621 tgcgactaga accggagaca ttacgccatg aacaagagcg ccgccgctgg cctgctgggc

     1681 tatgcccgcg tcagcaccga cgaccaggac ttgaccaacc aacgggccga actgcacgcg

     1741 gccggctgca ccaagctgtt ttccgagaag atcaccggca ccaggcgcga ccgcccggag

     1801 ctggccagga tgcttgacca cctacgccct ggcgacgttg tgacagtgac caggctagac

     1861 cgcctggccc gcagcacccg cgacctactg gacattgccg agcgcatcca ggaggccggc

     1921 gcgggcctgc gtagcctggc agagccgtgg gccgacacca ccacgccggc cggccgcatg

     1981 gtgttgaccg tgttcgccgg cattgccgag ttcgagcgtt ccctaatcat cgaccgcacc

     2041 cggagcgggc gcgaggccgc caaggcccga ggcgtgaagt ttggcccccg ccctaccctc

     2101 accccggcac agatcgcgca cgcccgcgag ctgatcgacc aggaaggccg caccgtgaaa

     2161 gaggcggctg cactgcttgg cgtgcatcgc tcgaccctgt accgcgcact tgagcgcagc

     2221 gaggaagtga cgcccaccga ggccaggcgg cgcggtgcct tccgtgagga cgcattgacc

     2281 gaggccgacg ccctggcggc cgccgagaat gaacgccaag aggaacaagc atgaaaccgc

     2341 accaggacgg ccaggacgaa ccgtttttca ttaccgaaga gatcgaggcg gagatgatcg

     2401 cggccgggta cgtgttcgag ccgcccgcgc acgtctcaac cgtgcggctg catgaaatcc

     2461 tggccggttt gtctgatgcc aagctggcgg cctggccggc cagcttggcc gctgaagaaa

     2521 ccgagcgccg ccgtctaaaa aggtgatgtg tatttgagta aaacagcttg cgtcatgcgg

     2581 tcgctgcgta tatgatgcga tgagtaaata aacaaatacg caaggggaac gcatgaaggt

     2641 tatcgctgta cttaaccaga aaggcgggtc aggcaagacg accatcgcaa cccatctagc

     2701 ccgcgccctg caactcgccg gggccgatgt tctgttagtc gattccgatc cccagggcag

     2761 tgcccgcgat tgggcggccg tgcgggaaga tcaaccgcta accgttgtcg gcatcgaccg

     2821 cccgacgatt gaccgcgacg tgaaggccat cggccggcgc gacttcgtag tgatcgacgg

     2881 agcgccccag gcggcggact tggctgtgtc cgcgatcaag gcagccgact tcgtgctgat

     2941 tccggtgcag ccaagccctt acgacatatg ggccaccgcc gacctggtgg agctggttaa

     3001 gcagcgcatt gaggtcacgg atggaaggct acaagcggcc tttgtcgtgt cgcgggcgat

     3061 caaaggcacg cgcatcggcg gtgaggttgc cgaggcgctg gccgggtacg agctgcccat

     3121 tcttgagtcc cgtatcacgc agcgcgtgag ctacccaggc actgccgccg ccggcacaac

     3181 cgttcttgaa tcagaacccg agggcgacgc tgcccgcgag gtccaggcgc tggccgctga

     3241 aattaaatca aaactcattt gagttaatga ggtaaagaga aaatgagcaa aagcacaaac

     3301 acgctaagtg ccggccgtcc gagcgcacgc agcagcaagg ctgcaacgtt ggccagcctg

     3361 gcagacacgc cagccatgaa gcgggtcaac tttcagttgc cggcggagga tcacaccaag

     3421 ctgaagatgt acgcggtacg ccaaggcaag accattaccg agctgctatc tgaatacatc

     3481 gcgcagctac cagagtaaat gagcaaatga ataaatgagt agatgaattt tagcggctaa

     3541 aggaggcggc atggaaaatc aagaacaacc aggcaccgac gccgtggaat gccccatgtg

     3601 tggaggaacg ggcggttggc caggcgtaag cggctgggtt gtctgccggc cctgcaatgg

     3661 cactggaacc cccaagcccg aggaatcggc gtgacggtcg caaaccatcc ggcccggtac

     3721 aaatcggcgc ggcgctgggt gatgacctgg tggagaagtt gaaggccgcg caggccgccc

     3781 agcggcaacg catcgaggca gaagcacgcc ccggtgaatc gtggcaagcg gccgctgatc

     3841 gaatccgcaa agaatcccgg caaccgccgg cagccggtgc gccgtcgatt aggaagccgc

     3901 ccaagggcga cgagcaacca gattttttcg ttccgatgct ctatgacgtg ggcacccgcg

     3961 atagtcgcag catcatggac gtggccgttt tccgtctgtc gaagcgtgac cgacgagctg

     4021 gcgaggtgat ccgctacgag cttccagacg ggcacgtaga ggtttccgca gggccggccg

     4081 gcatggccag tgtgtgggat tacgacctgg tactgatggc ggtttcccat ctaaccgaat

     4141 ccatgaaccg ataccgggaa gggaagggag acaagcccgg ccgcgtgttc cgtccacacg

     4201 ttgcggacgt actcaagttc tgccggcgag ccgatggcgg aaagcagaaa gacgacctgg

     4261 tagaaacctg cattcggtta aacaccacgc acgttgccat gcagcgtacg aagaaggcca

     4321 agaacggccg cctggtgacg gtatccgagg gtgaagcctt gattagccgc tacaagatcg

     4381 taaagagcga aaccgggcgg ccggagtaca tcgagatcga gctagctgat tggatgtacc

     4441 gcgagatcac agaaggcaag aacccggacg tgctgacggt tcaccccgat tactttttga

     4501 tcgatcccgg catcggccgt tttctctacc gcctggcacg ccgcgccgca ggcaaggcag

     4561 aagccagatg gttgttcaag acgatctacg aacgcagtgg cagcgccgga gagttcaaga

     4621 agttctgttt caccgtgcgc aagctgatcg ggtcaaatga cctgccggag tacgatttga

     4681 aggaggaggc ggggcaggct ggcccgatcc tagtcatgcg ctaccgcaac ctgatcgagg

     4741 gcgaagcatc cgccggttcc taatgtacgg agcagatgct agggcaaatt gccctagcag

     4801 gggaaaaagg tcgaaaaggt ctctttcctg tggatagcac gtacattggg aacccaaagc

     4861 cgtacattgg gaaccggaac ccgtacattg ggaacccaaa gccgtacatt gggaaccggt

     4921 cacacatgta agtgactgat ataaaagaga aaaaaggcga tttttccgcc taaaactctt

     4981 taaaacttat taaaactctt aaaacccgcc tggcctgtgc ataactgtct ggccagcgca

     5041 cagccgaaga gctgcaaaaa gcgcctaccc ttcggtcgct gcgctcccta cgccccgccg

     5101 cttcgcgtcg gcctatcgcg gccgctggcc gctcaaaaat ggctggccta cggccaggca

     5161 atctaccagg gcgcggacaa gccgcgccgt cgccactcga ccgccggcgc ccacatcaag

     5221 gcaccctgcc tcgcgcgttt cggtgatgac ggtgaaaacc tctgacacat gcagctcccg

     5281 gagacggtca cagcttgtct gtaagcggat gccgggagca gacaagcccg tcagggcgcg

     5341 tcagcgggtg ttggcgggtg tcggggcgca gccatgaccc agtcacgtag cgatagcgga

     5401 gtgtatactg gcttaactat gcggcatcag agcagattgt actgagagtg caccatatgc

     5461 ggtgtgaaat accgcacaga tgcgtaagga gaaaataccg catcaggcgc tcttccgctt

     5521 cctcgctcac tgactcgctg cgctcggtcg ttcggctgcg gcgagcggta tcagctcact

     5581 caaaggcggt aatacggtta tccacagaat caggggataa cgcaggaaag aacatgtgag

     5641 caaaaggcca gcaaaaggcc aggaaccgta aaaaggccgc gttgctggcg tttttccata

     5701 ggctccgccc ccctgacgag catcacaaaa atcgacgctc aagtcagagg tggcgaaacc

     5761 cgacaggact ataaagatac caggcgtttc cccctggaag ctccctcgtg cgctctcctg

     5821 ttccgaccct gccgcttacc ggatacctgt ccgcctttct cccttcggga agcgtggcgc

     5881 tttctcatag ctcacgctgt aggtatctca gttcggtgta ggtcgttcgc tccaagctgg

     5941 gctgtgtgca cgaacccccc gttcagcccg accgctgcgc cttatccggt aactatcgtc

     6001 ttgagtccaa cccggtaaga cacgacttat cgccactggc agcagccact ggtaacagga

     6061 ttagcagagc gaggtatgta ggcggtgcta cagagttctt gaagtggtgg cctaactacg

     6121 gctacactag aaggacagta tttggtatct gcgctctgct gaagccagtt accttcggaa

     6181 aaagagttgg tagctcttga tccggcaaac aaaccaccgc tggtagcggt ggtttttttg

     6241 tttgcaagca gcagattacg cgcagaaaaa aaggatctca agaagatcct ttgatctttt

     6301 ctacggggtc tgacgctcag tggaacgaaa actcacgtta agggattttg gtcatgcatt

     6361 ctaggtacta aaacaattca tccagtaaaa tataatattt tattttctcc caatcaggct

     6421 tgatccccag taagtcaaaa aatagctcga catactgttc ttccccgata tcctccctga

     6481 tcgaccggac gcagaaggca atgtcatacc acttgtccgc cctgccgctt ctcccaagat

     6541 caataaagcc acttactttg ccatctttca caaagatgtt gctgtctccc aggtcgccgt

     6601 gggaaaagac aagttcctct tcgggctttt ccgtctttaa aaaatcatac agctcgcgcg

     6661 gatctttaaa tggagtgtct tcttcccagt tttcgcaatc cacatcggcc agatcgttat

     6721 tcagtaagta atccaattcg gctaagcggc tgtctaagct attcgtatag ggacaatccg

     6781 atatgtcgat ggagtgaaag agcctgatgc actccgcata cagctcgata atcttttcag

     6841 ggctttgttc atcttcatac tcttccgagc aaaggacgcc atcggcctca ctcatgagca

     6901 gattgctcca gccatcatgc cgttcaaagt gcaggacctt tggaacaggc agctttcctt

     6961 ccagccatag catcatgtcc ttttcccgtt ccacatcata ggtggtccct ttataccggc

     7021 tgtccgtcat ttttaaatat aggttttcat tttctcccac cagcttatat accttagcag

     7081 gagacattcc ttccgtatct tttacgcagc ggtatttttc gatcagtttt ttcaattccg

     7141 gtgatattct cattttagcc atttattatt tccttcctct tttctacagt atttaaagat

     7201 accccaagaa gctaattata acaagacgaa ctccaattca ctgttccttg cattctaaaa

     7261 ccttaaatac cagaaaacag ctttttcaaa gttgttttca aagttggcgt ataacatagt

     7321 atcgacggag ccgattttga aaccgcggtg atcacaggca gcaacgctct gtcatcgtta

     7381 caatcaacat gctaccctcc gcgagatcat ccgtgtttca aacccggcag cttagttgcc

     7441 gttcttccga atagcatcgg taacatgagc aaagtctgcc gccttacaac ggctctcccg

     7501 ctgacgccgt cccggactga tgggctgcct gtatcgagtg gtgattttgt gccgagctgc

     7561 cggtcgggga gctgttggct ggctggtggc aggatatatt gtggtgtaaa caaattgacg

     7621 cttagacaac ttaataacac attgcggacg tttttaatgt actgaattaa cgccgaatta

     7681 attcggggga tctggatttt agtactggat tttggtttta ggaattagaa attttattga

     7741 tagaagtatt ttacaaatac aaatacatac taagggtttc ttatatgctc aacacatgag

     7801 cgaaacccta taggaaccct aattccctta tctgggaact actcacacat tattatggag

     7861 aaactcgagt caaatctcgg tgacgggcag gaccggacgg ggcggtaccg gcaggctgaa

     7921 gtccagctgc cagaaaccca cgtcatgcca gttcccgtgc ttgaagccgg ccgcccgcag

     7981 catgccgcgg ggggcatatc cgagcgcctc gtgcatgcgc acgctcgggt cgttgggcag

     8041 cccgatgaca gcgaccacgc tcttgaagcc ctgtgcctcc agggacttca gcaggtgggt

     8101 gtagagcgtg gagcccagtc ccgtccgctg gtggcggggg gagacgtaca cggtcgactc

     8161 ggccgtccag tcgtaggcgt tgcgtgcctt ccaggggccc gcgtaggcga tgccggcgac

     8221 ctcgccgtcc acctcggcga cgagccaggg atagcgctcc cgcagacgga cgaggtcgtc

     8281 cgtccactcc tgcggttcct gcggctcggt acggaagttg accgtgcttg tctcgatgta

     8341 gtggttgacg atggtgcaga ccgccggcat gtccgcctcg gtggcacggc ggatgtcggc

     8401 cgggcgtcgt tctgggctca tggtagac


Product is for research use only!



Search name

pCAMBIA3300,Plasmid pCAMBIA3300,pCAMBIA3300 vector

No customer comments for the moment.

Add A Comment

Related Products


No products

Total $0.00

Prices don't include postage.
