pCANTAB- 5E

$193.00

  • Model: PVT10573
  • 44 Units in Stock
Ask a question


Add to Cart:

pCANTAB-5E


Catalog No. PVT10573                                                    
Packing 2ug

 

pCANTAB-5E Description

This system is used for antibody gene expression and preparation of recombinant antibody. The host strain TG1 was replicated and expressed by plasmid vector pCANTAB5e, and was cultured on 2 *YT medium at 37 C. The vector pCANTAB5e is used to construct recombinant scFv. It has ampicillin resistance and the size is 4522 bp. The auxiliary phage M13K07 is used to rescue the phage particles. It is Kana-resistant and can be replicated by the auxiliary phage and expressed on the phage surface in the form of fusion. There is a sequence encoding Tag tail peptide (E-Tag) behind the scFv gene. There is an amber termination codon behind the tail peptide. It is located between the scFv gene and the cpIII gene. In the inhibitory bacteria TG1, only 20% of the amber codon is effective, so it can be read through the protein translation process to form scFv-cp. In non-inhibitory strains, such as HB2151, the terminator is recognized, and the scFv gene terminates before the cpIII gene in the translation process, forming an independent antibody protein that remains in the cell membrane gap, and leaks into the culture medium after a long period of culture to form soluble expression.

 

[Operation method]

This method comes from the network. This platform has not been confirmed by experiments, for reference only.

 

1. preparation of auxiliary phage virus species

 

1) the auxiliary bacteriophage M13K07 was crossed on the 2 * YT agar plate.

 

2) Prepare 2 *YT semi-solid agar (0.7% agar) as top Agar, cool to 50 ~C, take 4 mL Top Agar and add 0.5 mL overnight culture of fresh TG1 bacteria (OD660 up to 0.8), fully mix, along the line concentration from low to high direction, pour Top Agar;

 

3) Cultured at 37 C for 6-12 hours, single plaque was selected by inoculation needle, inoculated at 30-200 mL 2 YT-K (kanamycin 70 UG / mL), and cultured at 37 C for 10-14 hours.

 

4) 8000 rpm centrifugation 15 min, 4 C;

 

5) Take the supernatant carefully, and suggest that 0.45 micron filter membrane be used to filter, then pack aseptic tubules and store them at 4 C for at least half a year.

 

2. titration of bacteriophages

 

1) prepare 2 x YT culture plates without any antibiotics; 5-6.

2) 0.7% agar plate was prepared with 2 *YT medium, namely Top Agar, which was cooled to 42 C and stored at 42 C.

3) the above bacteriophage solution was diluted with 10-6, 10-7, 10-8, 10-9 and 10-10 with the medium.

4) Take the overnight culture of TG1 bacterial solution (OD660 = 1 or so), pack small test tube, 500 mu L / small test tube, marked 10-6 to 10-10 dilution;

Remarks: preparation of host bacteria should be carried out according to the instructions of TG1 strain.

5) Add 100 mu L of the phage diluted successively in step 3 above to each standard dilution tube, mix well, and oscillate gently at 37 C for 30 min.

6) Add Top Agar 3 mL to each tube, pour the prepared dishes immediately, and incubate at 37 C overnight.

7) calculate the number of plaque on the plate, multiplied by the corresponding dilution multiple, and the general concentration can reach 1012pfu/mL.

[note]

1. bacteriophage virus species should be titrated according to the recommended method before using.

2. phage virus species can be stored at 4 degrees centigrade, not frozen at -20 or lower temperatures.

 

pCANTAB-5E Information

Function E.coli Cloning plasmid
Promoter: Lac/lac promoter

Plasmid size: 4522bp

5 'sequencing primer and sequence: pcantab5-r1: ccatgatacgccagcttggagcc

3 'sequencing primer and sequence: pcantab5-r2: cgatctaaaagttgtcgtctttcc

Prokaryotic resistance: Ampicillin/ Amp

Clone strain: Escherichia coli Stbl3

Culture conditions: 37℃, aerobic, LB

 


pCANTAB-5E Sequence

GACGAAAGGGCCTCGTGATACGCCTATTTTTATAGGTTAATGTCATGATAATAATGGTTTCTTAGACGTCAGGTGGCACT
TTTCGGGGAAATGTGCGCGGAACCCCTATTTGTTTATTTTTCTAAATACATTCAAATATGTATCCGCTCATGAGACAATA
ACCCTGATAAATGCTTCAATAATATTGAAAAAGGAAGAGTATGAGTATTCAACATTTCCGTGTCGCCCTTATTCCCTTTT
TTGCGGCATTTTGCCTTCCTGTTTTTGCTCACCCAGAAACGCTGGTGAAAGTAAAAGATGCTGAAGATCAGTTGGGTGCT
CGAGTGGGTTACATCGAACTGGATCTCAACAGCGGTAAGATCCTTGAGAGTTTTCGCCCCGAAGAACGTTTTCCAATGAT
GAGCACTTTTAAAGTTCTGCTATGTGGCGCGGTATTATCCCGTATTGACGCCGGGCAAGAGCAACTCGGTCGCCGCATAC
ACTATTCTCAGAATGACTTGGTTGAGTACTCACCAGTCACAGAAAAGCATCTTACGGATGGCATGACAGTAAGAGAATTA
TGCAGTGCTGCCATAACCATGAGTGATAACACTGCGGCCAACTTACTTCTGACAACGATCGGAGGACCGAAGGAGCTAAC
CGCTTTTTTGCACAACATGGGGGATCATGTAACTCGCCTTGATCGTTGGGAACCGGAGCTGAATGAAGCCATACCAAACG
ACGAGCGTGACACCACGATGCCTGTAGCAATGGCAACAACGTTGCGCAAACTATTAACTGGCGAACTACTTACTCTAGCT
TCCCGGCAACAATTAATAGACTGGATGGAGGCGGATAAAGTTGCAGGACCACTTCTGCGCTCGGCCCTTCCGGCTGGCTG
GTTTATTGCTGATAAATCTGGAGCCGGTGAGCGTGGGTCTCGCGGTATCATTGCAGCACTGGGGCCAGATGGTAAGCCCT
CCCGTATCGTAGTTATCTACACGACGGGGAGTCAGGCAACTATGGATGAACGAAATAGACAGATCGCTGAGATAGGTGCC
TCACTGATTAAGCATTGGTAACTGTCAGACCAAGTTTACTCATATATACTTTAGATTGATTTAAAACTTCATTTTTAATT
TAAAAGGATCTAGGTGAAGATCCTTTTTGATAATCTCATGACCAAAATCCCTTAACGTGAGTTTTCGTTCCACTGAGCGT
CAGACCCCGTAGAAAAGATCAAAGGATCTTCTTGAGATCCTTTTTTTCTGCGCGTAATCTGCTGCTTGCAAACAAAAAAA
CCACCGCTACCAGCGGTGGTTTGTTTGCCGGATCAAGAGCTACCAACTCTTTTTCCGAAGGTAACTGGCTTCAGCAGAGC
GCAGATACCAAATACTGTTCTTCTAGTGTAGCCGTAGTTAGGCCACCACTTCAAGAACTCTGTAGCACCGCCTACATACC
TCGCTCTGCTAATCCTGTTACCAGTGGCTGCTGCCAGTGGCGATAAGTCGTGTCTTACCGGGTTGGACTCAAGACGATAG
TTACCGGATAAGGCGCAGCGGTCGGGCTGAACGGGGGGTTCGTGCATACAGCCCAGCTTGGAGCGAACGACCTACACCGA
ACTGAGATACCTACAGCGTGAGCTATGAGAAAGCGCCACGCTTCCCGAAGGGAGAAAGGCGGACAGGTATCCGGTAAGCG
GCAGGGTCGGAACAGGAGAGCGCACGAGGGAGCTTCCAGGGGGAAACGCCTGGTATCTTTATAGTCCTGTCGGGTTTCGC
CACCTCTGACTTGAGCGTCGATTTTTGTGATGCTCGTCAGGGGGGCGGAGCCTATGGAAAAACGCCAGCAACGCGGCCTT
TTTACGGTTCCTGGCCTTTTGCTGGCCTTTTGCTCACATGTTCTTTCCTGCGTTATCCCCTGATTCTGTGGATAACCGTA
TTACCGCCTTTGAGTGAGCTGATACCGCTCGCCGCAGCCGAACGACCGAGCGCAGCGAGTCAGTGAGCGAGGAAGCGGAA
GAGCGCCCAATACGCAAACCGCCTCTCCCCGCGCGTTGGCCGATTCATTAATGCAGCTGGCACGACAGGTTTCCCGACTG
GAAAGCGGGCAGTGAGCGCAACGCAATTAATGTGAGTTAGCTCACTCATTAGGCACCCCAGGCTTTACACTTTATGCTTC
CGGCTCGTATGTTGTGTGGAATTGTGAGCGGATAACAATTTCACACAGGAAACAGCTATGACCATGATTACGCCAAGCTT
TGGAGCCTTTTTTTTGGAGATTTTCAACGTGAAAAAATTATTATTCGCAATTCCTTTAGTTGTTCCTTTCTATGCGGCCC
AGCCGGCCATGGCCCAGGTGAAGCTGCAGCAGTCAGGACCTGGCCTGGTGGCGCCCTCACAGAGCCTGTCCATCACATGC
ACCGTCTCAGGGTTTTCATTAACCAGCTATGGTGTACACTGGGTTCGCCAGCCTCCAGGAAAGGGTCTGGAGTGGCTGGG
AGTAATATGGGCTGGTGGAAGCACAAACTATAATTCAGCTCTCAAATCCAGACTGAACATCAGCAAGGACAACTCCAAGA
GCCAAGTTTTCTTAAAAATGAACAGTCTCCAAACTGATGACACAGCCATGTACTACTGTGCCAGAAACTGGGGCAGCTAC
TGGTACTTCGATGTCTGGGGCCAAGGCCACGGTCACCGTCTCCTCAGTGGAGGCGGTTCAGGCGGAGGTGGCGGAGGTGG
CTCTGGCGGTGGCGGATCGGACATTGAGCTCACCCAGTCTCCAGCAATCATGTCTGCATCTCCAGGGGAAAAGGTCACCA
TGACCTGCAGGGCCAGCTCAAGTATAAGTTCCAGTTACTTGCACTGGTACCAGCAGAAGTCAGGCGCTTCCCCCAAACCC
TTGATTCATAGGACATCCAACCTGGCTTCTGGAGTCCCAGCTCGCTTCAGTGGCAGTGGGTCTGGGACCTCTTACTCTCT
CACAATCAGCAGCGTGGAGGCTGAAGATGATGCAACTTATTACTGCCAGCAGTGGAGTGGTTACCCATTCACGTTCGGTG
CTGGGACCAAGCTCGAGATCAAACGGGCGGCCGCAGGTGCGCCGGTGCCGTATCCGGATCCGCTGGAACCGCGTGCCGCA
TAGACTGTTGAAAGTTGTTTAGCAAAACCTCATACAGAAAATTCATTTACTAACGTCTGGAAAGACGACAAAACTTTAGA
TCGTTACGCTAACTATGAGGGCTGTCTGTGGAATGCTACAGGCGTTGTGGTTTGTACTGGTGACGAAACTCAGTGTTACG
GTACATGGGTTCCTATTGGGCTTGCTATCCCTGAAAATGAGGGTGGTGGCTCTGAGGGTGGCGGTTCTGAGGGTGGCGGT
TCTGAGGGTGGCGGTACTAAACCTCCTGAGTACGGTGATACACCTATTCCGGGCTATACTTATATCAACCCTCTCGACGG
CACTTATCCGCCTGGTACTGAGCAAAACCCCGCTAATCCTAATCCTTCTCTTGAGGAGTCTCAGCCTCTTAATACTTTCA
TGTTTCAGAATAATAGGTTCCGAAATAGGCAGGGTGCATTAACTGTTTATACGGGCACTGTTACTCAAGGCACTGACCCC
GTTAAAACTTATTACCAGTACACTCCTGTATCATCAAAAGCCATGTATGACGCTTACTGGAACGGTAAATTCAGAGACTG
CGCTTTCCATTCTGGCTTTAATGAGGATCCATTCGTTTGTGAATATCAAGGCCAATCGTCTGACCTGCCTCAACCTCCTG
TCAATGCTGGCGGCGGCTCTGGTGGTGGTTCTGGTGGCGGCTCTGAGGGTGGCGGCTCTGAGGGTGGCGGCTCTGAGGGT
GGCGGTTCTGAGGGTGGCGGCTCTGAGGGTGGCGGTTCCGGTGGCGGCTCCGGTTCCGGTGATTTTGATTATGAAAAAAT
GGCAAACGCTAATAAGGGGGCTATGACCGAAAATGCCGATGAAAACGCGCTACAGTCTGACGCTAAAGGCAAACTTGATT
CTGTCGCTACTGATTACGGTGCTGCTATCGATGGTTTCATTGGTGACGTTTCCGGCCTTGCTAATGGTAATGGTGCTACT
GGTGATTTTGCTGGCTCTAATTCCCAAATGGCTCAAGTCGGTGACGGTGATAATTCACCTTTAATGAATAATTTCCGTCA
ATATTTACCTTCTTTGCCTCAGTCGGTTGAATGTCGCCCTTATGTCTTTGGCGCTGGTAAACCATATGAATTTTCTATTG
ATTGTGACAAAATAAACTTATTCCGTGGTGTCTTTGCGTTTCTTTTATATGTTGCCACCTTTATGTATGTATTTTCGACG
TTTGCTAACATACTGCGTAATAAGGAGTCTTAATAAGAATTCACTGGCCGTCGTTTTACAACGTCGTGACTGGGAAAACC
CTGGCGTTACCCAACTTAATCGCCTTGCAGCACATCCCCCTTTCGCCAGCTGGCGTAATAGCGAAGAGGCCCGCACCGAT
CGCCCTTCCCAACAGTTGCGCAGCCTGAATGGCGAATGGCGCCTGATGCGGTATTTTCTCCTTACGCATCTGTGCGGTAT
TTCACACCGCATACGTCAAAGCAACCATAGTACGCGCCCTGTAGCGGCGCATTAAGCGCGGCGGGTGTGGTGGTTACGCG
CAGCGTGACCGCTACACTTGCCAGCGCCTTAGCGCCCGCTCCTTTCGCTTTCTTCCCTTCCTTTCTCGCCACGTTCGCCG
GCTTTCCCCGTCAAGCTCTAAATCGGGGGCTCCCTTTAGGGTTCCGATTTAGTGCTTTACGGCACCTCGACCCCAAAAAA
CTTGATTTGGGTGATGGTTCACGTAGTGGGCCATCGCCCTGATAGACGGTTTTTCGCCCTTTGACGTTGGAGTCCACGTT
CTTTAATAGTGGACTCTTGTTCCAAACTGGAACAACACTCAACTCTATCTCGGGCTATTCTTTTGATTTATAAGGGATTT
TGCCGATTTCGGTCTATTGGTTAAAAAATGAGCTGATTTAACAAAAATTTAACGCGAATTTTAACAAAATATTAACGTTT
ACAATTTTATGGTGCAGTCTCAGTACAATCTGCTCTGATGCCGCATAGTTAAGCCAGCCCCGACACCCGCCAACACCCGC
TGACGCGCCCTGACGGGCTTGTCTGCTCCCGGCATCCGCTTACAGACAAGCTGTGACCGTCTCCGGGAGCTGCATGTGTC
AGAGGTTTTCACCGTCATCACCGAAACGCGCGA

//

 

Caution:
Product is for research use only!

No customer comments for the moment.

Add A Comment

Related Products

Cart  

No products

Total $0.00

Prices don't include postage.

Cart