

  • Model: PVT6317
  • 50 Units in Stock
Ask a question

Add to Cart:


PVT6317    2ug


pCas9 Information

Replicon: p15A ori

Plasmid classification: Escherichia coli plasmids; Escherichia coli plasmids; large intestine Cas9 plasmids

Plasmid size: 9326bp

Prokaryotic resistance: chloramphenicol Chl (50 mu g/ml)

Cloned strains of Escherichia coli, Stbl3 and other Escherichia coli

Culture conditions: 37 centigrade, LB, aerobic

Expression host: Escherichia coli

Induction mode: no induction

5'sequencing primers: StrepPyoCas9-5UTR-F (CGGTGCCACTTTTTCAAGTTG)

3'sequencing primers: pBRrevBam (GGTGATGTCGGCGATATAGG)

Use:CRISPR-CAS26-sgRNA plasmid


pCas9 Description

pCas9 plasmid is a CRISPR/Cas9 system carrier. The replicator is p15A ori and ori. The plasmid size is 9326bp, which can be transformed into the corresponding host cells. The mass raising condition is LB, 37 C.

PCas9 can express Cas9 protein in Escherichia coli, and pCRISPR can be used for gene knockout, low copy plasmid, Bacterial expression of Cas9 nuclease, tracrRNA and crRNA.

PCas9 can often be difficult to target double-stranded breaks (DSBs) with the precision that is necessary for various genome editing applications. The ability to engineer Cas9 derivatives with purposefully altered PAM specificities would address this limitation. Here we show that the commonly used Streptococcus pyogenes Cas9 (SpCas9) can be modified to recognize alternative PAM sequences using structural information, bacterial selection-baseddirected evolution, and combinatorial design. CRISPR-Cas9 nucleases enable efficient genome editing in a wide variety of organisms and cell types Target recognition by Cas9. Site is programmed by a chimeric single guide RNA (sgRNA) that encodes a sequence complementary to a target protospacer5, but a LSO requires recognition of a short neighboring PAM the most robust. SpCas9, and widely used Cas9 to date, primarily recognizes NGG PAMs and is consequently restricted to sites that contain this motif It therefore be challenging. Can to implement genome editing applications that require precision, such as: homology-directed repair (HDR), which is most efficient when DSBs are placed within BPS of a desired 10 - 20 alteration; the introduction of variable-length insertion or deletion (indel) mutations into small size genetic elements such as microRNAs, splice sites, short open reading frames, or transcription factor binding sites by non-homologous end-joining (NHEJ); and allele-specific editing, where PAM recognition might be exploited to Differentiate alleles.




pCas9 Sequence

LOCUS       Exported                9326 bp ds-DNA     circular SYN 28-JUN-2017
DEFINITION  synthetic circular DNA
SOURCE      synthetic DNA construct
  ORGANISM  synthetic DNA construct
REFERENCE   1  (bases 1 to 9326)
  TITLE     Direct Submission
  JOURNAL   Exported Wednesday, June 28, 2017 
FEATURES             Location/Qualifiers
     source          1..9326
                     /organism="synthetic DNA construct"
                     /mol_type="other DNA"
     promoter        complement(220..322)
                     /note="cat promoter"
                     /note="promoter of the E. coli cat gene encoding
                     chloramphenicol acetyltransferase"
     rep_origin      complement(848..1393)
                     /note="p15A ori"
                     /note="Plasmids containing the medium-copy-number p15A
                     origin of replication can be propagated in E. coli cells
                     that contain a second plasmid with the ColE1 origin."
     promoter        1505..1533
                     /note="tet promoter"
                     /note="E. coli promoter for tetracycline efflux protein
     misc_RNA        complement(1851..1929)
                     /note="trans-activating CRISPR RNA for the Streptococcus
                     pyogenes CRISPR/Cas9 system"
     CDS             2225..6331
                     /product="Cas9 (Csn1) endonuclease from the Streptococcus
                     pyogenes Type II CRISPR/Cas system"
                     /note="generates RNA-guided double strand breaks in DNA"
     misc_feature    6352..6483
                     /note="crRNA leader"
                     /note="crRNA leader sequence for the Streptococcus pyogenes
                     CRISPR/Cas system"
     repeat_region   6484..6519
                     /note="direct repeat for the Streptococcus pyogenes
                     CRISPR/Cas system"
     repeat_region   6550..6585
                     /note="direct repeat for the Streptococcus pyogenes
                     CRISPR/Cas system"
     CDS             complement(8886..219)
                     /product="chloramphenicol acetyltransferase"
                     /note="confers resistance to chloramphenicol"
        1 gaattccgga tgagcattca tcaggcgggc aagaatgtga ataaaggccg gataaaactt
       61 gtgcttattt ttctttacgg tctttaaaaa ggccgtaata tccagctgaa cggtctggtt
      121 ataggtacat tgagcaactg actgaaatgc ctcaaaatgt tctttacgat gccattggga
      181 tatatcaacg gtggtatatc cagtgatttt tttctccatt ttagcttcct tagctcctga
      241 aaatctcgat aactcaaaaa atacgcccgg tagtgatctt atttcattat ggtgaaagtt
      301 ggaacctctt acgtgccgat caacgtctca ttttcgccaa aagttggccc agggcttccc
      361 ggtatcaaca gggacaccag gatttattta ttctgcgaag tgatcttccg tcacaggtat
      421 ttattcggcg caaagtgcgt cgggtgatgc tgccaactta ctgatttagt gtatgatggt
      481 gtttttgagg tgctccagtg gcttctgttt ctatcagctg tccctcctgt tcagctactg
      541 acggggtggt gcgtaacggc aaaagcaccg ccggacatca gcgctagcgg agtgtatact
      601 ggcttactat gttggcactg atgagggtgt cagtgaagtg cttcatgtgg caggagaaaa
      661 aaggctgcac cggtgcgtca gcagaatatg tgatacagga tatattccgc ttcctcgctc
      721 actgactcgc tacgctcggt cgttcgactg cggcgagcgg aaatggctta cgaacggggc
      781 ggagatttcc tggaagatgc caggaagata cttaacaggg aagtgagagg gccgcggcaa
      841 agccgttttt ccataggctc cgcccccctg acaagcatca cgaaatctga cgctcaaatc
      901 agtggtggcg aaacccgaca ggactataaa gataccaggc gtttccccct ggcggctccc
      961 tcgtgcgctc tcctgttcct gcctttcggt ttaccggtgt cattccgctg ttatggccgc
     1021 gtttgtctca ttccacgcct gacactcagt tccgggtagg cagttcgctc caagctggac
     1081 tgtatgcacg aaccccccgt tcagtccgac cgctgcgcct tatccggtaa ctatcgtctt
     1141 gagtccaacc cggaaagaca tgcaaaagca ccactggcag cagccactgg taattgattt
     1201 agaggagtta gtcttgaagt catgcgccgg ttaaggctaa actgaaagga caagttttgg
     1261 tgactgcgct cctccaagcc agttacctcg gttcaaagag ttggtagctc agagaacctt
     1321 cgaaaaaccg ccctgcaagg cggttttttc gttttcagag caagagatta cgcgcagacc
     1381 aaaacgatct caagaagatc atcttattaa tcagataaaa tatttctaga tttcagtgca
     1441 atttatctct tcaaatgtag cacctgaagt cagccccata cgatataagt tgtaattctc
     1501 atgtttgaca gcttatcatc gataagcttt aatgcggtag tttatcacag ttaaattgct
     1561 aacgcagtca ggcaccgtgt atgaaatcta acaatgcgct catcgtcatc ctcggcaccg
     1621 tcaccctgga tgctgtaggc ataggcttgg ttatgccggt actgccgggc ctcttgcggg
     1681 attacgaaat catcctgtgg agcttagtag gtttagcaag atggcagcgc ctaaatgtag
     1741 aatgataaaa ggattaagag attaatttcc ctaaaaatga taaaacaagc gttttgaaag
     1801 cgcttgtttt tttggtttgc agtcagagta gaatagaagt atcaaaaaaa gcaccgactc
     1861 ggtgccactt tttcaagttg ataacggact agccttattt taacttgcta tgctgttttg
     1921 aatggttcca acaagattat tttataactt ttataacaaa taatcaagga gaaattcaaa
     1981 gaaatttatc agccataaaa caatacttaa tactatagaa tgataacaaa ataaactact
     2041 ttttaaaaga attttgtgtt ataatctatt tattattaag tattgggtaa tattttttga
     2101 agagatattt tgaaaaagaa aaattaaagc atattaaact aatttcggag gtcattaaaa
     2161 ctattattga aatcatcaaa ctcattatgg atttaattta aactttttat tttaggaggc
     2221 aaaaatggat aagaaatact caataggctt agatatcggc acaaatagcg tcggatgggc
     2281 ggtgatcact gatgaatata aggttccgtc taaaaagttc aaggttctgg gaaatacaga
     2341 ccgccacagt atcaaaaaaa atcttatagg ggctctttta tttgacagtg gagagacagc
     2401 ggaagcgact cgtctcaaac ggacagctcg tagaaggtat acacgtcgga agaatcgtat
     2461 ttgttatcta caggagattt tttcaaatga gatggcgaaa gtagatgata gtttctttca
     2521 tcgacttgaa gagtcttttt tggtggaaga agacaagaag catgaacgtc atcctatttt
     2581 tggaaatata gtagatgaag ttgcttatca tgagaaatat ccaactatct atcatctgcg
     2641 aaaaaaattg gtagattcta ctgataaagc ggatttgcgc ttaatctatt tggccttagc
     2701 gcatatgatt aagtttcgtg gtcatttttt gattgaggga gatttaaatc ctgataatag
     2761 tgatgtggac aaactattta tccagttggt acaaacctac aatcaattat ttgaagaaaa
     2821 ccctattaac gcaagtggag tagatgctaa agcgattctt tctgcacgat tgagtaaatc
     2881 aagacgatta gaaaatctca ttgctcagct ccccggtgag aagaaaaatg gcttatttgg
     2941 gaatctcatt gctttgtcat tgggtttgac ccctaatttt aaatcaaatt ttgatttggc
     3001 agaagatgct aaattacagc tttcaaaaga tacttacgat gatgatttag ataatttatt
     3061 ggcgcaaatt ggagatcaat atgctgattt gtttttggca gctaagaatt tatcagatgc
     3121 tattttactt tcagatatcc taagagtaaa tactgaaata actaaggctc ccctatcagc
     3181 ttcaatgatt aaacgctacg atgaacatca tcaagacttg actcttttaa aagctttagt
     3241 tcgacaacaa cttccagaaa agtataaaga aatctttttt gatcaatcaa aaaacggata
     3301 tgcaggttat attgatgggg gagctagcca agaagaattt tataaattta tcaaaccaat
     3361 tttagaaaaa atggatggta ctgaggaatt attggtgaaa ctaaatcgtg aagatttgct
     3421 gcgcaagcaa cggacctttg acaacggctc tattccccat caaattcact tgggtgagct
     3481 gcatgctatt ttgagaagac aagaagactt ttatccattt ttaaaagaca atcgtgagaa
     3541 gattgaaaaa atcttgactt ttcgaattcc ttattatgtt ggtccattgg cgcgtggcaa
     3601 tagtcgtttt gcatggatga ctcggaagtc tgaagaaaca attaccccat ggaattttga
     3661 agaagttgtc gataaaggtg cttcagctca atcatttatt gaacgcatga caaactttga
     3721 taaaaatctt ccaaatgaaa aagtactacc aaaacatagt ttgctttatg agtattttac
     3781 ggtttataac gaattgacaa aggtcaaata tgttactgaa ggaatgcgaa aaccagcatt
     3841 tctttcaggt gaacagaaga aagccattgt tgatttactc ttcaaaacaa atcgaaaagt
     3901 aaccgttaag caattaaaag aagattattt caaaaaaata gaatgttttg atagtgttga
     3961 aatttcagga gttgaagata gatttaatgc ttcattaggt acctaccatg atttgctaaa
     4021 aattattaaa gataaagatt ttttggataa tgaagaaaat gaagatatct tagaggatat
     4081 tgttttaaca ttgaccttat ttgaagatag ggagatgatt gaggaaagac ttaaaacata
     4141 tgctcacctc tttgatgata aggtgatgaa acagcttaaa cgtcgccgtt atactggttg
     4201 gggacgtttg tctcgaaaat tgattaatgg tattagggat aagcaatctg gcaaaacaat
     4261 attagatttt ttgaaatcag atggttttgc caatcgcaat tttatgcagc tgatccatga
     4321 tgatagtttg acatttaaag aagacattca aaaagcacaa gtgtctggac aaggcgatag
     4381 tttacatgaa catattgcaa atttagctgg tagccctgct attaaaaaag gtattttaca
     4441 gactgtaaaa gttgttgatg aattggtcaa agtaatgggg cggcataagc cagaaaatat
     4501 cgttattgaa atggcacgtg aaaatcagac aactcaaaag ggccagaaaa attcgcgaga
     4561 gcgtatgaaa cgaatcgaag aaggtatcaa agaattagga agtcagattc ttaaagagca
     4621 tcctgttgaa aatactcaat tgcaaaatga aaagctctat ctctattatc tccaaaatgg
     4681 aagagacatg tatgtggacc aagaattaga tattaatcgt ttaagtgatt atgatgtcga
     4741 tcacattgtt ccacaaagtt tccttaaaga cgattcaata gacaataagg tcttaacgcg
     4801 ttctgataaa aatcgtggta aatcggataa cgttccaagt gaagaagtag tcaaaaagat
     4861 gaaaaactat tggagacaac ttctaaacgc caagttaatc actcaacgta agtttgataa
     4921 tttaacgaaa gctgaacgtg gaggtttgag tgaacttgat aaagctggtt ttatcaaacg
     4981 ccaattggtt gaaactcgcc aaatcactaa gcatgtggca caaattttgg atagtcgcat
     5041 gaatactaaa tacgatgaaa atgataaact tattcgagag gttaaagtga ttaccttaaa
     5101 atctaaatta gtttctgact tccgaaaaga tttccaattc tataaagtac gtgagattaa
     5161 caattaccat catgcccatg atgcgtatct aaatgccgtc gttggaactg ctttgattaa
     5221 gaaatatcca aaacttgaat cggagtttgt ctatggtgat tataaagttt atgatgttcg
     5281 taaaatgatt gctaagtctg agcaagaaat aggcaaagca accgcaaaat atttctttta
     5341 ctctaatatc atgaacttct tcaaaacaga aattacactt gcaaatggag agattcgcaa
     5401 acgccctcta atcgaaacta atggggaaac tggagaaatt gtctgggata aagggcgaga
     5461 ttttgccaca gtgcgcaaag tattgtccat gccccaagtc aatattgtca agaaaacaga
     5521 agtacagaca ggcggattct ccaaggagtc aattttacca aaaagaaatt cggacaagct
     5581 tattgctcgt aaaaaagact gggatccaaa aaaatatggt ggttttgata gtccaacggt
     5641 agcttattca gtcctagtgg ttgctaaggt ggaaaaaggg aaatcgaaga agttaaaatc
     5701 cgttaaagag ttactaggga tcacaattat ggaaagaagt tcctttgaaa aaaatccgat
     5761 tgacttttta gaagctaaag gatataagga agttaaaaaa gacttaatca ttaaactacc
     5821 taaatatagt ctttttgagt tagaaaacgg tcgtaaacgg atgctggcta gtgccggaga
     5881 attacaaaaa ggaaatgagc tggctctgcc aagcaaatat gtgaattttt tatatttagc
     5941 tagtcattat gaaaagttga agggtagtcc agaagataac gaacaaaaac aattgtttgt
     6001 ggagcagcat aagcattatt tagatgagat tattgagcaa atcagtgaat tttctaagcg
     6061 tgttatttta gcagatgcca atttagataa agttcttagt gcatataaca aacatagaga
     6121 caaaccaata cgtgaacaag cagaaaatat tattcattta tttacgttga cgaatcttgg
     6181 agctcccgct gcttttaaat attttgatac aacaattgat cgtaaacgat atacgtctac
     6241 aaaagaagtt ttagatgcca ctcttatcca tcaatccatc actggtcttt atgaaacacg
     6301 cattgatttg agtcagctag gaggtgactg aagtatattt tagatgaaga ttatttctta
     6361 ataactaaaa atatggtata atactcttaa taaatgcagt aatacagggg cttttcaaga
     6421 ctgaagtcta gctgagacaa atagtgcgat tacgaaattt tttagacaaa aatagtctac
     6481 gaggttttag agctatgctg ttttgaatgg tcccaaaact gagaccagtc tcggaagctc
     6541 aaaggtctcg ttttagagct atgctgtttt gaatggtccc aaaacttcag cacactgaga
     6601 cttgttgagt tccatgtttt agagctatgc tgttttgaat ggactccatt caacattgcc
     6661 gatgataact tgagaaagag ggttaatacc agcagtcgga taccttccta ttctttctgt
     6721 taaagcgttt tcatgttata ataggcaaaa gaagagtagt gtgatcgtcc attccgacag
     6781 catcgccagt cactatggcg tgctgctagc gctatatgcg ttgatgcaat ttctatgcgc
     6841 acccgttctc ggagcactgt ccgaccgctt tggccgccgc ccagtcctgc tcgcttcgct
     6901 acttggagcc actatcgact acgcgatcat ggcgaccaca cccgtcctgt ggatcctcta
     6961 cgccggacgc atcgtggccg gcatcaccgg cgccacaggt gcggttgctg gcgcctatat
     7021 cgccgacatc accgatgggg aagatcgggc tcgccacttc gggctcatga gcgcttgttt
     7081 cggcgtgggt atggtggcag gccccgtggc cgggggactg ttgggcgcca tctccttgca
     7141 tgcaccattc cttgcggcgg cggtgctcaa cggcctcaac ctactactgg gctgcttcct
     7201 aatgcaggag tcgcataagg gagagcgtcg accgatgccc ttgagagcct tcaacccagt
     7261 cagctccttc cggtgggcgc ggggcatgac tatcgtcgcc gcacttatga ctgtcttctt
     7321 tatcatgcaa ctcgtaggac aggtgccggc agcgctctgg gtcattttcg gcgaggaccg
     7381 ctttcgctgg agcgcgacga tgatcggcct gtcgcttgcg gtattcggaa tcttgcacgc
     7441 cctcgctcaa gccttcgtca ctggtcccgc caccaaacgt ttcggcgaga agcaggccat
     7501 tatcgccggc atggcggccg acgcgctggg ctacgtcttg ctggcgttcg cgacgcgagg
     7561 ctggatggcc ttccccatta tgattcttct cgcttccggc ggcatcggga tgcccgcgtt
     7621 gcaggccatg ctgtccaggc aggtagatga cgaccatcag ggacagcttc aaggatcgct
     7681 cgcggctctt accagcctaa cttcgatcat tggaccgctg atcgtcacgg cgatttatgc
     7741 cgcctcggcg agcacatgga acgggttggc atggattgta ggcgccgccc tataccttgt
     7801 ctgcctcccc gcgttgcgtc gcggtgcatg gagccgggcc acctcgacct gaatggaagc
     7861 cggcggcacc tcgctaacgg attcaccact ccaagaattg gagccaatca attcttgcgg
     7921 agaactgtga atgcgcaaac caacccttgg cagaacatat ccatcgcgtc cgccatctcc
     7981 agcagccgca cgcggcgcat ctcgggcagc gttgggtcct ggccacgggt gcgcatgatc
     8041 gtgctcctgt cgttgaggac ccggctaggc tggcggggtt gccttactgg ttagcagaat
     8101 gaatcaccga tacgcgagcg aacgtgaagc gactgctgct gcaaaacgtc tgcgacctga
     8161 gcaacaacat gaatggtctt cggtttccgt gtttcgtaaa gtctggaaac gcggaagtcc
     8221 cctacgtgct gctgaagttg cccgcaacag agagtggaac caaccggtga taccacgata
     8281 ctatgactga gagtcaacgc catgagcggc ctcatttctt attctgagtt acaacagtcc
     8341 gcaccgctgt ccggtagctc cttccggtgg gcgcggggca tgactatcgt cgccgcactt
     8401 atgactgtct tctttatcat gcaactcgta ggacaggtgc cggcagcgcc caacagtccc
     8461 ccggccacgg ggcctgccac catacccacg ccgaaacaag cgccctgcac cattatgttc
     8521 cggatctgca tcgcaggatg ctgctggcta ccctgtggaa cacctacatc tgtattaacg
     8581 aagcgctaac cgtttttatc aggctctggg aggcagaata aatgatcata tcgtcaatta
     8641 ttacctccac ggggagagcc tgagcaaact ggcctcaggc atttgagaag cacacggtca
     8701 cactgcttcc ggtagtcaat aaaccggtaa accagcaata gacataagcg gctatttaac
     8761 gaccctgccc tgaaccgacg accgggtcga atttgctttc gaatttctgc cattcatccg
     8821 cttattatca cttattcagg cgtagcacca ggcgtttaag ggcaccaata actgccttaa
     8881 aaaaattacg ccccgccctg ccactcatcg cagtactgtt gtaattcatt aagcattctg
     8941 ccgacatgga agccatcaca gacggcatga tgaacctgaa tcgccagcgg catcagcacc
     9001 ttgtcgcctt gcgtataata tttgcccatg gtgaaaacgg gggcgaagaa gttgtccata
     9061 ttggccacgt ttaaatcaaa actggtgaaa ctcacccagg gattggctga gacgaaaaac
     9121 atattctcaa taaacccttt agggaaatag gccaggtttt caccgtaaca cgccacatct
     9181 tgcgaatata tgtgtagaaa ctgccggaaa tcgtcgtggt attcactcca gagcgatgaa
     9241 aacgtttcag tttgctcatg gaaaacggtg taacaagggt gaacactatc ccatatcacc
     9301 agctcaccgt ctttcattgc catacg


1.  This product is FOR RESEARCH USE ONLY!
2.  The item is lyophilized form, Please take the powder plasmid by centrifugation at 5000rpm/min for 1min. Add 20μl ddH2O in to the tube of plasmid.


Search name

pCas9,Plasmid pCas9,pCas9 vector

No customer comments for the moment.

Add A Comment

Related Products


No products

Total $0.00

Prices don't include postage.
