pCas9 Plasmid


  • Model: PVT6317
  • 50 Units in Stock
Ask a question

Add to Cart:


Search name

pCas9,Plasmid pCas9,pCas9 vector


pCas9 Information

Replicon: p15A ori

Plasmid classification: Escherichia coli plasmids; Escherichia coli plasmids; large intestine Cas9 plasmids

Plasmid size: 9326bp

Prokaryotic resistance: chloramphenicol Chl (50 mu g/ml)

Cloned strains of Escherichia coli, Stbl3 and other Escherichia coli

Culture conditions: 37 centigrade, LB, aerobic

Expression host: Escherichia coli

Induction mode: no induction

5'sequencing primers: StrepPyoCas9-5UTR-F (CGGTGCCACTTTTTCAAGTTG)

3'sequencing primers: pBRrevBam (GGTGATGTCGGCGATATAGG)

Use:CRISPR-CAS26-sgRNA plasmid


pCas9 Description

pCas9 plasmid is a CRISPR/Cas9 system carrier. The replicator is p15A ori and ori. The plasmid size is 9326bp, which can be transformed into the corresponding host cells. The mass raising condition is LB, 37 C.

PCas9 can express Cas9 protein in Escherichia coli, and pCRISPR can be used for gene knockout, low copy plasmid, Bacterial expression of Cas9 nuclease, tracrRNA and crRNA and.

PCas9 can often be difficult to target double-stranded breaks (DSBs) with the precision that is necessary for various genome editing applications. The ability to engineer Cas9 derivatives with purposefully altered PAM specificities would address this limitation. Here we show that the commonly used Streptococcus pyogenes Cas9 (SpCas9) can be modified to recognize alternative PAM sequences using structural information, bacterial selection-baseddirected evolution, and combinatorial design. CRISPR-Cas9 nucleases enable efficient genome editing in a wide variety of organisms and cell types Target recognition by Cas9. Site is programmed by a chimeric single guide RNA (sgRNA) that encodes a sequence complementary to a target protospacer5, but a LSO requires recognition of a short neighboring PAM the most robust. SpCas9, and widely used Cas9 to date, primarily recognizes NGG PAMs and is consequently restricted to sites that contain this motif It therefore be challenging. Can to implement genome editing applications that require precision, such as: homology-directed repair (HDR), which is most efficient when DSBs are placed within BPS of a desired 10 - 20 alteration; the introduction of variable-length insertion or deletion (indel) mutations into small size genetic elements such as microRNAs, splice sites, short open reading frames, or transcription factor binding sites by non-homologous end-joining (NHEJ); and allele-specific editing, where PAM recognition might be exploited to Differentiate alleles.




pCas9 Sequence

LOCUS       Exported                9326 bp ds-DNA     circular SYN 28-JUN-2017
DEFINITION  synthetic circular DNA
SOURCE      synthetic DNA construct
  ORGANISM  synthetic DNA construct
REFERENCE   1  (bases 1 to 9326)
  TITLE     Direct Submission
  JOURNAL   Exported Wednesday, June 28, 2017  
FEATURES             Location/Qualifiers
     source          1..9326
                     /organism="synthetic DNA construct"
                     /mol_type="other DNA"
     promoter        complement(220..322)
                     /note="cat promoter"
                     /note="promoter of the E. coli cat gene encoding
                     chloramphenicol acetyltransferase"
     rep_origin      complement(848..1393)
                     /note="p15A ori"
                     /note="Plasmids containing the medium-copy-number p15A
                     origin of replication can be propagated in E. coli cells
                     that contain a second plasmid with the ColE1 origin."
     promoter        1505..1533
                     /note="tet promoter"
                     /note="E. coli promoter for tetracycline efflux protein
     misc_RNA        complement(1851..1929)
                     /note="trans-activating CRISPR RNA for the Streptococcus
                     pyogenes CRISPR/Cas9 system"
     CDS             2225..6331
                     /product="Cas9 (Csn1) endonuclease from the Streptococcus
                     pyogenes Type II CRISPR/Cas system"
                     /note="generates RNA-guided double strand breaks in DNA"
     misc_feature    6352..6483
                     /note="crRNA leader"
                     /note="crRNA leader sequence for the Streptococcus pyogenes
                     CRISPR/Cas system"
     repeat_region   6484..6519
                     /note="direct repeat for the Streptococcus pyogenes
                     CRISPR/Cas system"
     repeat_region   6550..6585
                     /note="direct repeat for the Streptococcus pyogenes
                     CRISPR/Cas system"
     CDS             complement(8886..219)
                     /product="chloramphenicol acetyltransferase"
                     /note="confers resistance to chloramphenicol"
        1 gaattccgga tgagcattca tcaggcgggc aagaatgtga ataaaggccg gataaaactt
       61 gtgcttattt ttctttacgg tctttaaaaa ggccgtaata tccagctgaa cggtctggtt
      121 ataggtacat tgagcaactg actgaaatgc ctcaaaatgt tctttacgat gccattggga
      181 tatatcaacg gtggtatatc cagtgatttt tttctccatt ttagcttcct tagctcctga
      241 aaatctcgat aactcaaaaa atacgcccgg tagtgatctt atttcattat ggtgaaagtt
      301 ggaacctctt acgtgccgat caacgtctca ttttcgccaa aagttggccc agggcttccc
      361 ggtatcaaca gggacaccag gatttattta ttctgcgaag tgatcttccg tcacaggtat
      421 ttattcggcg caaagtgcgt cgggtgatgc tgccaactta ctgatttagt gtatgatggt
      481 gtttttgagg tgctccagtg gcttctgttt ctatcagctg tccctcctgt tcagctactg
      541 acggggtggt gcgtaacggc aaaagcaccg ccggacatca gcgctagcgg agtgtatact
      601 ggcttactat gttggcactg atgagggtgt cagtgaagtg cttcatgtgg caggagaaaa
      661 aaggctgcac cggtgcgtca gcagaatatg tgatacagga tatattccgc ttcctcgctc
No customer comments for the moment.

Add A Comment

Related Products


No products

Total $0.00

Prices don't include postage.
