pCDEF- HA- Ub- K11R

$215.00

  • Model: PVT10380
  • 50 Units in Stock
Ask a question


Add to Cart:

pCDEF-HA-Ub-K11R

Catalog No. PVT10380
Packing 2ug

 

pCDEF-HA-Ub-K11R Information

Function ORF expression plasmid
Resistance Amp
Screen /
Strain DH5alpha
Culture temperature 37degrees centigrade

pCDEF-HA-Ub-K11R Description

PCDEF-HA-Ub-K11R plasmid is an expression plasmid of mammalian cells. The prokaryotic resistance is Amp (ampicillin). It is mainly used to express Ub gene in mammalian cells and its related research.

 

1, there are 7 lysine in the Ub gene, which are sixth, 11, 27, 29, 33, 48, 63. The pCDEF-HA-Ub-K11R plasmids only turn eleventh lysine into arginine and retain the remaining six lysine, which can be used to study which site of the Ub chain.

2, the pCDEF carrier is constructed with pCDEF-HA-N

3, the original sequence of the UbC gene:

ATGCAAATCTTCGTGAAGACACTCACTGGCAAGACCATCACCCTTGAGGTCGAGCCCAGTGACACTATCGAGAACGTCAAAGCAAAGATCCAAGACAAGGAAGGCATTCCTCCTGACCAGCAGAGGTTGATCTTTGCCGGAAAGCAGCTGGAAGATGGGCGCACCCTGTCTGACTACAACATCCAGAAAGAGTCTACCCTGCACCTGGTGCTCCGTCTCAGAGGTGGGTGA

pCDEF-HA-Ub-K11R sequence

No customer comments for the moment.

Add A Comment

Related Products

Cart  

No products

Total $0.00

Prices don't include postage.

Cart