pCDNA3.1 (+)


  • Model: PVT1004
  • 50 Units in Stock
Ask a question

Add to Cart:


PVT1004  2ug


pCDNA3.1(+) Information

Promoter: CMV promoter

Replicator: SV40 ori, pUC ori, F1 ori

Terminator: BGH poly (A) signal

Plasmid classification: lactation serial plasmid; lactation expression plasmid; pCDNA series plasmid.

Plasmid size: 5428bp

Prokaryotic resistance: ampicillin Amp (100 g/ml)

Screening marker: neomycin Neo/G418

Cloning strains: E. coli DH5 and E.

Culture conditions: 37 C, aerobic, LB

Expression host: mammalian cells such as 293T

Culture conditions: 37 C, 5%CO2

Induction mode: no need to induce

5'sequencing primers: pCDNA3.1-F (CTAGAGAACCCACTGCTTAC)

3'sequencing primers: pCDNA3.1-R (TAGAAGGCACAGTCGAGG)


pCDNA3.1(+) Description

PCDNA3.1 (+) is a 5.4 KB vector from pCDNA3, designed for high-level stable and transient expression in mammalian hosts. Most mammalian cells can perform high levels of stable and non replicating transient expression. Human cytomegalovirus immediate early (CMV) promoter is used for high level expression in a wide range of mammalian cells. Multiple cloning sites in the forward (+) and reverse (-) directions were used to facilitate the cloning of neomycin resistant genes for the selection of stable cell lines. Abnormal replication in cell lines with latent infection of SV40 or expression of SV40 large T antigen (e.g. COS-1, COS-7).


pcDNA3.1(+) and pcDNA3.1(-) are 5.4 kb vectors derived from pcDNA3 and designed for high-level stable and transient expression in mammalian hosts. High-level stable and non-replicative transient expression can be carried out in most mammalian cells. The vectors contain the following elements:
       • Human cytomegalovirus immediate-early (CMV) promoter for high-level expression in a wide range of mammalian cells
       • Multiple cloning sites in the forward (+) and reverse (-) orientations to facilitate cloning

       • Neomycin resistance gene for selection of stable cell lines
       • Episomal replication in cells lines that are latently infected with SV40 or that express the SV40 large T antigen (e.g. COS-1, COS-7). The control plasmid, pcDNA3.1/CAT, is included for use as a positive control for transfection and expression in the cell line of choice.
       This pcDNA3.1(+)vector is designed for high-level, constitutive expression in a variety of mammalian cell lines. It contains a Geneticin® selectable marker and a forward-orientation multiple cloning site.


pCDNA3.1(+) Multiple cloning site




pCDNA3.1(+) Sequence

LOCUS       Exported                5428 bp ds-DNA     circular SYN 18-SEPT-2016
DEFINITION  synthetic circular DNA
SOURCE      synthetic DNA construct
  ORGANISM  synthetic DNA construct
REFERENCE   1  (bases 1 to 5428)
  TITLE     Direct Submission
  JOURNAL   Exported 2016-9-18 
FEATURES             Location/Qualifiers
     source          1..5428
                     /organism="synthetic DNA construct"
                     /mol_type="other DNA"
     enhancer        202..581
                     /note="CMV enhancer"
                     /note="human cytomegalovirus immediate early enhancer"
     promoter        582..785
                     /note="CMV promoter"
                     /note="human cytomegalovirus (CMV) immediate early
     promoter        830..848
                     /note="T7 promoter"
                     /note="promoter for bacteriophage T7 RNA polymerase"
     polyA_signal    995..1219
                     /note="bGH poly(A) signal"
                     /note="bovine growth hormone polyadenylation signal"
     rep_origin      1265..1693
                     /note="f1 ori"
                     /note="f1 bacteriophage origin of replication; arrow
                     indicates direction of (+) strand synthesis"
     promoter        1707..2036
                     /note="SV40 promoter"
                     /note="SV40 enhancer and early promoter"
     rep_origin      1887..2022
                     /note="SV40 ori"
                     /note="SV40 origin of replication"
     CDS             2103..2897
                     /gene="aph(3')-II (or nptII)"
                     /product="aminoglycoside phosphotransferase from Tn5"
                     /note="confers resistance to neomycin, kanamycin, and G418
     polyA_signal    3071..3192
                     /note="SV40 poly(A) signal"
                     /note="SV40 polyadenylation signal"
     primer_bind     complement(3241..3257)
                     /note="M13 rev"
                     /note="common sequencing primer, one of multiple similar
     protein_bind    3265..3281
                     /bound_moiety="lac repressor encoded by lacI"
                     /note="lac operator"
                     /note="The lac repressor binds to the lac operator to
                     inhibit transcription in E. coli. This inhibition can be
                     relieved by adding lactose or
                     isopropyl-beta-D-thiogalactopyranoside (IPTG)."
     promoter        complement(3289..3319)
                     /note="lac promoter"
                     /note="promoter for the E. coli lac operon"
     protein_bind    3334..3355
                     /bound_moiety="E. coli catabolite activator protein"
                     /note="CAP binding site"
                     /note="CAP binding activates transcription in the presence
                     of cAMP."
     rep_origin      complement(3643..4228)
                     /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of
     CDS             complement(4399..5259)
                     /note="confers resistance to ampicillin, carbenicillin, and
                     related antibiotics"
     promoter        complement(5260..5364)
                     /note="AmpR promoter"
        1 gcactctcag tacaatctgc tctgatgccg catagttaag ccagtatctg ctccctgctt
       61 gtgtgttgga ggtcgctgag tagtgcgcga gcaaaattta agctacaaca aggcaaggct
      121 tgaccgacaa ttgcatgaag aatctgctta gggttaggcg ttttgcgctg cttcgcgatg
      181 tacgggccag atatacgcgt tgacattgat tattgactag ttattaatag taatcaatta
      241 cggggtcatt agttcatagc ccatatatgg agttccgcgt tacataactt acggtaaatg
      301 gcccgcctgg ctgaccgccc aacgaccccc gcccattgac gtcaataatg acgtatgttc
      361 ccatagtaac gccaataggg actttccatt gacgtcaatg ggtggagtat ttacggtaaa
      421 ctgcccactt ggcagtacat caagtgtatc atatgccaag tacgccccct attgacgtca
      481 atgacggtaa atggcccgcc tggcattatg cccagtacat gaccttatgg gactttccta
      541 cttggcagta catctacgta ttagtcatcg ctattaccat ggtgatgcgg ttttggcagt
      601 acatcaatgg gcgtggatag cggtttgact cacggggatt tccaagtctc caccccattg
      661 acgtcaatgg gagtttgttt tggcaccaaa atcaacggga ctttccaaaa tgtcgtaaca
      721 actccgcccc attgacgcaa atgggcggta ggcgtgtacg gtgggaggtc tatataagca
      781 gagctctctg gctaactaga gaacccactg cttactggct tatcgaaatt aatacgactc
      841 actataggga gacccaagct ggctagcgtt taaacttaag cttggtaccg agctcggatc
      901 cactagtcca gtgtggtgga attctgcaga tatccagcac agtggcggcc gctcgagtct
      961 agagggcccg tttaaacccg ctgatcagcc tcgactgtgc cttctagttg ccagccatct
     1021 gttgtttgcc cctcccccgt gccttccttg accctggaag gtgccactcc cactgtcctt
     1081 tcctaataaa atgaggaaat tgcatcgcat tgtctgagta ggtgtcattc tattctgggg
     1141 ggtggggtgg ggcaggacag caagggggag gattgggaag acaatagcag gcatgctggg
     1201 gatgcggtgg gctctatggc ttctgaggcg gaaagaacca gctggggctc tagggggtat
     1261 ccccacgcgc cctgtagcgg cgcattaagc gcggcgggtg tggtggttac gcgcagcgtg
     1321 accgctacac ttgccagcgc cctagcgccc gctcctttcg ctttcttccc ttcctttctc
     1381 gccacgttcg ccggctttcc ccgtcaagct ctaaatcggg ggctcccttt agggttccga
     1441 tttagtgctt tacggcacct cgaccccaaa aaacttgatt agggtgatgg ttcacgtagt
     1501 gggccatcgc cctgatagac ggtttttcgc cctttgacgt tggagtccac gttctttaat
     1561 agtggactct tgttccaaac tggaacaaca ctcaacccta tctcggtcta ttcttttgat
     1621 ttataaggga ttttgccgat ttcggcctat tggttaaaaa atgagctgat ttaacaaaaa
     1681 tttaacgcga attaattctg tggaatgtgt gtcagttagg gtgtggaaag tccccaggct
     1741 ccccagcagg cagaagtatg caaagcatgc atctcaatta gtcagcaacc aggtgtggaa
     1801 agtccccagg ctccccagca ggcagaagta tgcaaagcat gcatctcaat tagtcagcaa
     1861 ccatagtccc gcccctaact ccgcccatcc cgcccctaac tccgcccagt tccgcccatt
     1921 ctccgcccca tggctgacta atttttttta tttatgcaga ggccgaggcc gcctctgcct
     1981 ctgagctatt ccagaagtag tgaggaggct tttttggagg cctaggcttt tgcaaaaagc
     2041 tcccgggagc ttgtatatcc attttcggat ctgatcaaga gacaggatga ggatcgtttc
     2101 gcatgattga acaagatgga ttgcacgcag gttctccggc cgcttgggtg gagaggctat
     2161 tcggctatga ctgggcacaa cagacaatcg gctgctctga tgccgccgtg ttccggctgt
     2221 cagcgcaggg gcgcccggtt ctttttgtca agaccgacct gtccggtgcc ctgaatgaac
     2281 tgcaggacga ggcagcgcgg ctatcgtggc tggccacgac gggcgttcct tgcgcagctg
     2341 tgctcgacgt tgtcactgaa gcgggaaggg actggctgct attgggcgaa gtgccggggc
     2401 aggatctcct gtcatctcac cttgctcctg ccgagaaagt atccatcatg gctgatgcaa
     2461 tgcggcggct gcatacgctt gatccggcta cctgcccatt cgaccaccaa gcgaaacatc
     2521 gcatcgagcg agcacgtact cggatggaag ccggtcttgt cgatcaggat gatctggacg
     2581 aagagcatca ggggctcgcg ccagccgaac tgttcgccag gctcaaggcg cgcatgcccg
     2641 acggcgagga tctcgtcgtg acccatggcg atgcctgctt gccgaatatc atggtggaaa
     2701 atggccgctt ttctggattc atcgactgtg gccggctggg tgtggcggac cgctatcagg
     2761 acatagcgtt ggctacccgt gatattgctg aagagcttgg cggcgaatgg gctgaccgct
     2821 tcctcgtgct ttacggtatc gccgctcccg attcgcagcg catcgccttc tatcgccttc
     2881 ttgacgagtt cttctgagcg ggactctggg gttcgaaatg accgaccaag cgacgcccaa
     2941 cctgccatca cgagatttcg attccaccgc cgccttctat gaaaggttgg gcttcggaat
     3001 cgttttccgg gacgccggct ggatgatcct ccagcgcggg gatctcatgc tggagttctt
     3061 cgcccacccc aacttgttta ttgcagctta taatggttac aaataaagca atagcatcac
     3121 aaatttcaca aataaagcat ttttttcact gcattctagt tgtggtttgt ccaaactcat
     3181 caatgtatct tatcatgtct gtataccgtc gacctctagc tagagcttgg cgtaatcatg
     3241 gtcatagctg tttcctgtgt gaaattgtta tccgctcaca attccacaca acatacgagc
     3301 cggaagcata aagtgtaaag cctggggtgc ctaatgagtg agctaactca cattaattgc
     3361 gttgcgctca ctgcccgctt tccagtcggg aaacctgtcg tgccagctgc attaatgaat
     3421 cggccaacgc gcggggagag gcggtttgcg tattgggcgc tcttccgctt cctcgctcac
     3481 tgactcgctg cgctcggtcg ttcggctgcg gcgagcggta tcagctcact caaaggcggt
     3541 aatacggtta tccacagaat caggggataa cgcaggaaag aacatgtgag caaaaggcca
     3601 gcaaaaggcc aggaaccgta aaaaggccgc gttgctggcg tttttccata ggctccgccc
     3661 ccctgacgag catcacaaaa atcgacgctc aagtcagagg tggcgaaacc cgacaggact
     3721 ataaagatac caggcgtttc cccctggaag ctccctcgtg cgctctcctg ttccgaccct
     3781 gccgcttacc ggatacctgt ccgcctttct cccttcggga agcgtggcgc tttctcatag
     3841 ctcacgctgt aggtatctca gttcggtgta ggtcgttcgc tccaagctgg gctgtgtgca
     3901 cgaacccccc gttcagcccg accgctgcgc cttatccggt aactatcgtc ttgagtccaa
     3961 cccggtaaga cacgacttat cgccactggc agcagccact ggtaacagga ttagcagagc
     4021 gaggtatgta ggcggtgcta cagagttctt gaagtggtgg cctaactacg gctacactag
     4081 aagaacagta tttggtatct gcgctctgct gaagccagtt accttcggaa aaagagttgg
     4141 tagctcttga tccggcaaac aaaccaccgc tggtagcggt ttttttgttt gcaagcagca
     4201 gattacgcgc agaaaaaaag gatctcaaga agatcctttg atcttttcta cggggtctga
     4261 cgctcagtgg aacgaaaact cacgttaagg gattttggtc atgagattat caaaaaggat
     4321 cttcacctag atccttttaa attaaaaatg aagttttaaa tcaatctaaa gtatatatga
     4381 gtaaacttgg tctgacagtt accaatgctt aatcagtgag gcacctatct cagcgatctg
     4441 tctatttcgt tcatccatag ttgcctgact ccccgtcgtg tagataacta cgatacggga
     4501 gggcttacca tctggcccca gtgctgcaat gataccgcga gacccacgct caccggctcc
     4561 agatttatca gcaataaacc agccagccgg aagggccgag cgcagaagtg gtcctgcaac
     4621 tttatccgcc tccatccagt ctattaattg ttgccgggaa gctagagtaa gtagttcgcc
     4681 agttaatagt ttgcgcaacg ttgttgccat tgctacaggc atcgtggtgt cacgctcgtc
     4741 gtttggtatg gcttcattca gctccggttc ccaacgatca aggcgagtta catgatcccc
     4801 catgttgtgc aaaaaagcgg ttagctcctt cggtcctccg atcgttgtca gaagtaagtt
     4861 ggccgcagtg ttatcactca tggttatggc agcactgcat aattctctta ctgtcatgcc
     4921 atccgtaaga tgcttttctg tgactggtga gtactcaacc aagtcattct gagaatagtg
     4981 tatgcggcga ccgagttgct cttgcccggc gtcaatacgg gataataccg cgccacatag
     5041 cagaacttta aaagtgctca tcattggaaa acgttcttcg gggcgaaaac tctcaaggat
     5101 cttaccgctg ttgagatcca gttcgatgta acccactcgt gcacccaact gatcttcagc
     5161 atcttttact ttcaccagcg tttctgggtg agcaaaaaca ggaaggcaaa atgccgcaaa
     5221 aaagggaata agggcgacac ggaaatgttg aatactcata ctcttccttt ttcaatatta
     5281 ttgaagcatt tatcagggtt attgtctcat gagcggatac atatttgaat gtatttagaa
     5341 aaataaacaa ataggggttc cgcgcacatt tccccgaaaa gtgccacctg acgtcgacgg
     5401 atcgggagat ctcccgatcc cctatggt



Product is for research use only!

Search name

pCDNA3.1(+),Plasmid pCDNA3.1(+),pCDNA3.1(+) vector

No customer comments for the moment.

Add A Comment

Related Products


No products

Total $0.00

Prices don't include postage.
