pCDNA3.1- 3*HA- N


  • Model: PVT10681
  • 50 Units in Stock
Ask a question

Add to Cart:


​PVT10681  2ug


pCDNA3.1-3*HA-N Informaiton

Promoter: CMV promoter

Replicon: pUC ori, F1 ori

Terminator: BGH poly (A) signal

Plasmid classification: lactation serial plasmid; lactation expression plasmid; pCDNA series plasmid.

Plasmid size: 5541bp

Plasmid tagging: N-3 * HA

Prokaryotic resistance: ampicillin Amp (100 ug/ml)

Screening marker: neomycin Neo/G418

Cloning strains: E. coli DH5 alpha

Culture conditions: 37 C, aerobic, LB

Expression host: mammalian cells such as 293T

Culture conditions: 37 C, 5%CO2

Induction mode: no need to induce

5'sequencing primers: pCDNA3.1-F (CTAGAGAACCCACTGCTTAC)

3'sequencing primers: pCDNA3.1-R (TAGAAGGCACAGTCGAGG)


pCDNA3.1-3*HA-N Description

pCDNA3.1-3×HA-N vector is designed for high-level, constitutive expression in a variety of mammalian cell lines. It contains a Geneticin selectable marker and a forward-orientation multiple cloning site.High-level stable and non-replicative transient expression can be carried out in most mammalian cells. The vectors contain the following elements: Human cytomegalovirus immediate-early (CMV) promoter for high-level expression in a wide range of mammalian cells Neomycin resistance gene for selection of stable cell lines. There are three HA tags on the N side.Episomal replication in cells lines that are latently infected with SV40 or that express the SV40 large T antigen.


pCDNA3.1-3*HA-N Cloning site



pCDNA3.1-3*HA-N Sequence

LOCUS       Exported                5541 bp ds-DNA     circular SYN 18-JUL-2016
DEFINITION  synthetic circular DNA
SOURCE      synthetic DNA construct
  ORGANISM  synthetic DNA construct
REFERENCE   1  (bases 1 to 5541)
  TITLE     Direct Submission
  JOURNAL   Exported Monday, July 18, 2016 
FEATURES             Location/Qualifiers
     source          1..5541
                     /organism="synthetic DNA construct"
                     /mol_type="other DNA"
     enhancer        235..614
                     /note="CMV enhancer"
                     /note="human cytomegalovirus immediate early enhancer"
     promoter        615..818
                     /note="CMV promoter"
                     /note="human cytomegalovirus (CMV) immediate early
     promoter        863..881
                     /note="T7 promoter"
                     /note="promoter for bacteriophage T7 RNA polymerase"
     CDS             928..954
                     /product="HA (human influenza hemagglutinin) epitope tag"
     CDS             958..984
                     /product="HA (human influenza hemagglutinin) epitope tag"
     CDS             988..1014
                     /product="HA (human influenza hemagglutinin) epitope tag"
     polyA_signal    1141..1365
                     /note="bGH poly(A) signal"
                     /note="bovine growth hormone polyadenylation signal"
     rep_origin      1411..1839
                     /note="f1 ori"
                     /note="f1 bacteriophage origin of replication; arrow
                     indicates direction of (+) strand synthesis"
     promoter        1853..2182
                     /note="SV40 promoter"
                     /note="SV40 enhancer and early promoter"
     rep_origin      2033..2168
                     /note="SV40 ori"
                     /note="SV40 origin of replication"
     CDS             2249..3043
                     /gene="aph(3')-II (or nptII)"
                     /product="aminoglycoside phosphotransferase from Tn5"
                     /note="confers resistance to neomycin, kanamycin, and G418
     polyA_signal    3217..3338
                     /note="SV40 poly(A) signal"
                     /note="SV40 polyadenylation signal"
     primer_bind     complement(3387..3403)
                     /note="M13 rev"
                     /note="common sequencing primer, one of multiple similar
     protein_bind    3411..3427
                     /bound_moiety="lac repressor encoded by lacI"
                     /note="lac operator"
                     /note="The lac repressor binds to the lac operator to
                     inhibit transcription in E. coli. This inhibition can be
                     relieved by adding lactose or
                     isopropyl-beta-D-thiogalactopyranoside (IPTG)."
     promoter        complement(3435..3465)
                     /note="lac promoter"
                     /note="promoter for the E. coli lac operon"
     protein_bind    3480..3501
                     /bound_moiety="E. coli catabolite activator protein"
                     /note="CAP binding site"
                     /note="CAP binding activates transcription in the presence
                     of cAMP."
     rep_origin      complement(3789..4374)
                     /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of
     CDS             complement(4545..5405)
                     /note="confers resistance to ampicillin, carbenicillin, and
                     related antibiotics"
     promoter        complement(5406..5510)
                     /note="AmpR promoter"
        1 gacggatcgg gagatctccc gatcccctat ggtgcactct cagtacaatc tgctctgatg
       61 ccgcatagtt aagccagtat ctgctccctg cttgtgtgtt ggaggtcgct gagtagtgcg
      121 cgagcaaaat ttaagctaca acaaggcaag gcttgaccga caattgcatg aagaatctgc
      181 ttagggttag gcgttttgcg ctgcttcgcg atgtacgggc cagatatacg cgttgacatt
      241 gattattgac tagttattaa tagtaatcaa ttacggggtc attagttcat agcccatata
      301 tggagttccg cgttacataa cttacggtaa atggcccgcc tggctgaccg cccaacgacc
      361 cccgcccatt gacgtcaata atgacgtatg ttcccatagt aacgccaata gggactttcc
      421 attgacgtca atgggtggag tatttacggt aaactgccca cttggcagta catcaagtgt
      481 atcatatgcc aagtacgccc cctattgacg tcaatgacgg taaatggccc gcctggcatt
      541 atgcccagta catgacctta tgggactttc ctacttggca gtacatctac gtattagtca
      601 tcgctattac catggtgatg cggttttggc agtacatcaa tgggcgtgga tagcggtttg
      661 actcacgggg atttccaagt ctccacccca ttgacgtcaa tgggagtttg ttttggcacc
      721 aaaatcaacg ggactttcca aaatgtcgta acaactccgc cccattgacg caaatgggcg
      781 gtaggcgtgt acggtgggag gtctatataa gcagagctct ctggctaact agagaaccca
      841 ctgcttactg gcttatcgaa attaatacga ctcactatag ggagacccaa gctggctagc
      901 gtttaaactt aagccaccat ggcggcgtac ccatacgacg tacctgatta tgcaacttat
      961 ccttatgatg tacctgatta tgctagctat ccttatgatg tcccagacta cgcatcagcg
     1021 gaaaagcttg gtaccgagct cggatccact agtccagtgt ggtggaattc tgcagatatc
     1081 cagcacagtg gcggccgctc gagtctagag ggcccgttta aacccgctga tcagcctcga
     1141 ctgtgccttc tagttgccag ccatctgttg tttgcccctc ccccgtgcct tccttgaccc
     1201 tggaaggtgc cactcccact gtcctttcct aataaaatga ggaaattgca tcgcattgtc
     1261 tgagtaggtg tcattctatt ctggggggtg gggtggggca ggacagcaag ggggaggatt
     1321 gggaagacaa tagcaggcat gctggggatg cggtgggctc tatggcttct gaggcggaaa
     1381 gaaccagctg gggctctagg gggtatcccc acgcgccctg tagcggcgca ttaagcgcgg
     1441 cgggtgtggt ggttacgcgc agcgtgaccg ctacacttgc cagcgcccta gcgcccgctc
     1501 ctttcgcttt cttcccttcc tttctcgcca cgttcgccgg ctttccccgt caagctctaa
     1561 atcgggggct ccctttaggg ttccgattta gtgctttacg gcacctcgac cccaaaaaac
     1621 ttgattaggg tgatggttca cgtagtgggc catcgccctg atagacggtt tttcgccctt
     1681 tgacgttgga gtccacgttc tttaatagtg gactcttgtt ccaaactgga acaacactca
     1741 accctatctc ggtctattct tttgatttat aagggatttt gccgatttcg gcctattggt
     1801 taaaaaatga gctgatttaa caaaaattta acgcgaatta attctgtgga atgtgtgtca
     1861 gttagggtgt ggaaagtccc caggctcccc agcaggcaga agtatgcaaa gcatgcatct
     1921 caattagtca gcaaccaggt gtggaaagtc cccaggctcc ccagcaggca gaagtatgca
     1981 aagcatgcat ctcaattagt cagcaaccat agtcccgccc ctaactccgc ccatcccgcc
     2041 cctaactccg cccagttccg cccattctcc gccccatggc tgactaattt tttttattta
     2101 tgcagaggcc gaggccgcct ctgcctctga gctattccag aagtagtgag gaggcttttt
     2161 tggaggccta ggcttttgca aaaagctccc gggagcttgt atatccattt tcggatctga
     2221 tcaagagaca ggatgaggat cgtttcgcat gattgaacaa gatggattgc acgcaggttc
     2281 tccggccgct tgggtggaga ggctattcgg ctatgactgg gcacaacaga caatcggctg
     2341 ctctgatgcc gccgtgttcc ggctgtcagc gcaggggcgc ccggttcttt ttgtcaagac
     2401 cgacctgtcc ggtgccctga atgaactgca ggacgaggca gcgcggctat cgtggctggc
     2461 cacgacgggc gttccttgcg cagctgtgct cgacgttgtc actgaagcgg gaagggactg
     2521 gctgctattg ggcgaagtgc cggggcagga tctcctgtca tctcaccttg ctcctgccga
     2581 gaaagtatcc atcatggctg atgcaatgcg gcggctgcat acgcttgatc cggctacctg
     2641 cccattcgac caccaagcga aacatcgcat cgagcgagca cgtactcgga tggaagccgg
     2701 tcttgtcgat caggatgatc tggacgaaga gcatcagggg ctcgcgccag ccgaactgtt
     2761 cgccaggctc aaggcgcgca tgcccgacgg cgaggatctc gtcgtgaccc atggcgatgc
     2821 ctgcttgccg aatatcatgg tggaaaatgg ccgcttttct ggattcatcg actgtggccg
     2881 gctgggtgtg gcggaccgct atcaggacat agcgttggct acccgtgata ttgctgaaga
     2941 gcttggcggc gaatgggctg accgcttcct cgtgctttac ggtatcgccg ctcccgattc
     3001 gcagcgcatc gccttctatc gccttcttga cgagttcttc tgagcgggac tctggggttc
     3061 gaaatgaccg accaagcgac gcccaacctg ccatcacgag atttcgattc caccgccgcc
     3121 ttctatgaaa ggttgggctt cggaatcgtt ttccgggacg ccggctggat gatcctccag
     3181 cgcggggatc tcatgctgga gttcttcgcc caccccaact tgtttattgc agcttataat
     3241 ggttacaaat aaagcaatag catcacaaat ttcacaaata aagcattttt ttcactgcat
     3301 tctagttgtg gtttgtccaa actcatcaat gtatcttatc atgtctgtat accgtcgacc
     3361 tctagctaga gcttggcgta atcatggtca tagctgtttc ctgtgtgaaa ttgttatccg
     3421 ctcacaattc cacacaacat acgagccgga agcataaagt gtaaagcctg gggtgcctaa
     3481 tgagtgagct aactcacatt aattgcgttg cgctcactgc ccgctttcca gtcgggaaac
     3541 ctgtcgtgcc agctgcatta atgaatcggc caacgcgcgg ggagaggcgg tttgcgtatt
     3601 gggcgctctt ccgcttcctc gctcactgac tcgctgcgct cggtcgttcg gctgcggcga
     3661 gcggtatcag ctcactcaaa ggcggtaata cggttatcca cagaatcagg ggataacgca
     3721 ggaaagaaca tgtgagcaaa aggccagcaa aaggccagga accgtaaaaa ggccgcgttg
     3781 ctggcgtttt tccataggct ccgcccccct gacgagcatc acaaaaatcg acgctcaagt
     3841 cagaggtggc gaaacccgac aggactataa agataccagg cgtttccccc tggaagctcc
     3901 ctcgtgcgct ctcctgttcc gaccctgccg cttaccggat acctgtccgc ctttctccct
     3961 tcgggaagcg tggcgctttc tcatagctca cgctgtaggt atctcagttc ggtgtaggtc
     4021 gttcgctcca agctgggctg tgtgcacgaa ccccccgttc agcccgaccg ctgcgcctta
     4081 tccggtaact atcgtcttga gtccaacccg gtaagacacg acttatcgcc actggcagca
     4141 gccactggta acaggattag cagagcgagg tatgtaggcg gtgctacaga gttcttgaag
     4201 tggtggccta actacggcta cactagaaga acagtatttg gtatctgcgc tctgctgaag
     4261 ccagttacct tcggaaaaag agttggtagc tcttgatccg gcaaacaaac caccgctggt
     4321 agcggttttt ttgtttgcaa gcagcagatt acgcgcagaa aaaaaggatc tcaagaagat
     4381 cctttgatct tttctacggg gtctgacgct cagtggaacg aaaactcacg ttaagggatt
     4441 ttggtcatga gattatcaaa aaggatcttc acctagatcc ttttaaatta aaaatgaagt
     4501 tttaaatcaa tctaaagtat atatgagtaa acttggtctg acagttacca atgcttaatc
     4561 agtgaggcac ctatctcagc gatctgtcta tttcgttcat ccatagttgc ctgactcccc
     4621 gtcgtgtaga taactacgat acgggagggc ttaccatctg gccccagtgc tgcaatgata
     4681 ccgcgagacc cacgctcacc ggctccagat ttatcagcaa taaaccagcc agccggaagg
     4741 gccgagcgca gaagtggtcc tgcaacttta tccgcctcca tccagtctat taattgttgc
     4801 cgggaagcta gagtaagtag ttcgccagtt aatagtttgc gcaacgttgt tgccattgct
     4861 acaggcatcg tggtgtcacg ctcgtcgttt ggtatggctt cattcagctc cggttcccaa
     4921 cgatcaaggc gagttacatg atcccccatg ttgtgcaaaa aagcggttag ctccttcggt
     4981 cctccgatcg ttgtcagaag taagttggcc gcagtgttat cactcatggt tatggcagca
     5041 ctgcataatt ctcttactgt catgccatcc gtaagatgct tttctgtgac tggtgagtac
     5101 tcaaccaagt cattctgaga atagtgtatg cggcgaccga gttgctcttg cccggcgtca
     5161 atacgggata ataccgcgcc acatagcaga actttaaaag tgctcatcat tggaaaacgt
     5221 tcttcggggc gaaaactctc aaggatctta ccgctgttga gatccagttc gatgtaaccc
     5281 actcgtgcac ccaactgatc ttcagcatct tttactttca ccagcgtttc tgggtgagca
     5341 aaaacaggaa ggcaaaatgc cgcaaaaaag ggaataaggg cgacacggaa atgttgaata
     5401 ctcatactct tcctttttca atattattga agcatttatc agggttattg tctcatgagc
     5461 ggatacatat ttgaatgtat ttagaaaaat aaacaaatag gggttccgcg cacatttccc
     5521 cgaaaagtgc cacctgacgt c


Product is for research use only!

No customer comments for the moment.

Add A Comment

Related Products


No products

Total $0.00

Prices don't include postage.
