
  • Model: PVT10754
  • 50 Units in Stock
Ask a question

Add to Cart:



PVT10754     2ug


pCDNA3.1-EGFP Description

pCDNA3.1-EGFP is a Mammalian fluorescent plasmid


Promoter: CMV promoter

Replicon: pUC ori, F1 ori

Terminator: BGH poly (A) signal

Plasmid classification: lactation serial plasmid; lactation expression plasmid; pCDNA series plasmid.

Plasmid size: 6173bp

Plasmid tagging: C-EGFP

Prokaryotic resistance: ampicillin Amp (100 g/ml)

Screening marker: neomycin Neo/G418

Cloning strains: E. coli DH5 and E.

Culture conditions: 37 C, aerobic, LB

Expression host: mammalian cells such as 293T

Culture conditions: 37 C, 5%CO2

Induction mode: no need to induce

5'sequencing primers: pCDNA3.1-F (CTAGAGAACCCACTGCTTAC)

3'sequencing primers: pCDNA3.1-R (TAGAAGGCACAGTCGAGG)

Note: Restriction site is different from pCDNA3.1-EGFP(PVT10754)


pCDNA3.1-EGFP  was obtained by cloning the EGFP gene into the pCDNA3.1 vector. It was designed for stable and transient expression in mammalian hosts. Most mammalian cells can perform high levels of stable and non replicating transient expression. Human cytomegalovirus immediate early (CMV) promoter is used for high level expression in a wide range of mammalian cells. Abnormal replication in cell lines with latent infection of SV40 or expression of SV40 large T antigen (e.g. COS-1, COS-7).

The GFP in pcDNA3.1-eGFP stands for green fluorescent protein. Deoxyribonucleic acids (DNAs) are typically made up of protein, so it makes sense for a special protein to make up a specific type of DNA add-gene such as the pcDNA3.1.although other means besides cloning would also be openly discussed. In this study, a detailed overview of how pcDNA-eGFP can be produced through cloning is done thanks to the use of secondary sources; a proper review of the pcDNA3.1-eGFP is first carried out to understand this compound. Afterward, the importance of a vector in the cloning process is looked at in detail and finally the cloning system is covered extensivel GFP proteins are generally composed of 238 amino acids with molecular masses of around 26.9 KD [1] and are typically used in the field of molecular biology as one of the many reporter genes. Basically, a reporter gene is a type of gene that researchers, especially in laboratory experiments, use to attach to a pre-specified sequence of the gene (oftentimes an experimental one) such as that of bacteria, plants, animals, and cell cultures. Some of the criteria that researchers use when selecting a reporter gene include, but may not be limited to, having easily identifiable and selectable markers and their ability to introduce changes that tend to be easily spotted under certain conditions. When conducting laboratory experiments in molecular biology, it would be important for researchers to know the different variables involved and the impact that they create on the experimental environment. Therefore, it makes sense to select reporter genes that possess these qualities such as the GFP [1]. In previously published studies involving the use of GFPs, including but not limited to pcDNA3.1, it has been common for researchers to introduce the GFP gene into cells using vector-based systems. In some cases, the researchers also used recombinant viruses (attaching the GFP to them). Being used as a reporter protein, the location of the target protein can be easily identified and expressed. However, in many of the laboratory experiments, the selection market of the GFPs used was not specific enough and there is often no selection market to normalize the transfection among other reactions.


pCDNA3.1-EGFP Multiple cloning site



pCDNA3.1-EGFP Sequence

LOCUS       Exported                6173 bp ds-DNA     circular SYN 07-12-2015
DEFINITION  synthetic circular DNA
SOURCE      synthetic DNA construct
  ORGANISM  synthetic DNA construct
REFERENCE   1  (bases 1 to 6173)
  TITLE     Direct Submission
  JOURNAL   Exported 2016-9-18
FEATURES             Location/Qualifiers
     source          1..6173
                     /organism="synthetic DNA construct"
                     /mol_type="other DNA"
     enhancer        236..615
                     /note="CMV enhancer"
                     /note="human cytomegalovirus immediate early enhancer"
     promoter        616..819
                     /note="CMV promoter"
                     /note="human cytomegalovirus (CMV) immediate early
     promoter        864..882
                     /note="T7 promoter"
                     /note="promoter for bacteriophage T7 RNA polymerase"
     CDS             1003..1722
                     /product="enhanced GFP"
                     /note="mammalian codon-optimized"
     polyA_signal    1774..1998
                     /note="bGH poly(A) signal"
                     /note="bovine growth hormone polyadenylation signal"
     rep_origin      2044..2472
                     /note="f1 ori"
                     /note="f1 bacteriophage origin of replication; arrow
                     indicates direction of (+) strand synthesis"
     promoter        2486..2815
                     /note="SV40 promoter"
                     /note="SV40 enhancer and early promoter"
     rep_origin      2666..2801
                     /note="SV40 ori"
                     /note="SV40 origin of replication"
     CDS             2882..3676
                     /gene="aph(3')-II (or nptII)"
                     /product="aminoglycoside phosphotransferase from Tn5"
                     /note="confers resistance to neomycin, kanamycin, and G418
     polyA_signal    3850..3971
                     /note="SV40 poly(A) signal"
                     /note="SV40 polyadenylation signal"
     primer_bind     complement(4020..4036)
                     /note="M13 rev"
                     /note="common sequencing primer, one of multiple similar
     protein_bind    4044..4060
                     /bound_moiety="lac repressor encoded by lacI"
                     /note="lac operator"
                     /note="The lac repressor binds to the lac operator to
                     inhibit transcription in E. coli. This inhibition can be
                     relieved by adding lactose or
                     isopropyl-beta-D-thiogalactopyranoside (IPTG)."
     promoter        complement(4068..4098)
                     /note="lac promoter"
                     /note="promoter for the E. coli lac operon"
     protein_bind    4113..4134
                     /bound_moiety="E. coli catabolite activator protein"
                     /note="CAP binding site"
                     /note="CAP binding activates transcription in the presence
                     of cAMP."
     rep_origin      complement(4422..5007)
                     /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of
     CDS             complement(5178..6038)
                     /note="confers resistance to ampicillin, carbenicillin, and
                     related antibiotics"
     promoter        complement(6039..6143)
                     /note="AmpR promoter"
        1 cgacggatcg ggagatctcc cgatccccta tggtgcactc tcagtacaat ctgctctgat
       61 gccgcatagt taagccagta tctgctccct gcttgtgtgt tggaggtcgc tgagtagtgc
      121 gcgagcaaaa tttaagctac aacaaggcaa ggcttgaccg acaattgcat gaagaatctg
      181 cttagggtta ggcgttttgc gctgcttcgc gatgtacggg ccagatatac gcgttgacat
      241 tgattattga ctagttatta atagtaatca attacggggt cattagttca tagcccatat
      301 atggagttcc gcgttacata acttacggta aatggcccgc ctggctgacc gcccaacgac
      361 ccccgcccat tgacgtcaat aatgacgtat gttcccatag taacgccaat agggactttc
      421 cattgacgtc aatgggtgga gtatttacgg taaactgccc acttggcagt acatcaagtg
      481 tatcatatgc caagtacgcc ccctattgac gtcaatgacg gtaaatggcc cgcctggcat
      541 tatgcccagt acatgacctt atgggacttt cctacttggc agtacatcta cgtattagtc
      601 atcgctatta ccatggtgat gcggttttgg cagtacatca atgggcgtgg atagcggttt
      661 gactcacggg gatttccaag tctccacccc attgacgtca atgggagttt gttttggcac
      721 caaaatcaac gggactttcc aaaatgtcgt aacaactccg ccccattgac gcaaatgggc
      781 ggtaggcgtg tacggtggga ggtctatata agcagagctc tctggctaac tagagaaccc
      841 actgcttact ggcttatcga aattaatacg actcactata gggagaccca agctggctag
      901 cgtttaaact taagcttggt accgagctcg gatccactag tccagtgtgg tggaattctg
      961 cagtcgacgg taccgcgggc ccgggatcca ccggtcgcca ccatggtgag caagggcgag
     1021 gagctgttca ccggggtggt gcccatcctg gtcgagctgg acggcgacgt aaacggccac
     1081 aagttcagcg tgtccggcga gggcgagggc gatgccacct acggcaagct gaccctgaag
     1141 ttcatctgca ccaccggcaa gctgcccgtg ccctggccca ccctcgtgac caccctgacc
     1201 tacggcgtgc agtgcttcag ccgctacccc gaccacatga agcagcacga cttcttcaag
     1261 tccgccatgc ccgaaggcta cgtccaggag cgcaccatct tcttcaagga cgacggcaac
     1321 tacaagaccc gcgccgaggt gaagttcgag ggcgacaccc tggtgaaccg catcgagctg
     1381 aagggcatcg acttcaagga ggacggcaac atcctggggc acaagctgga gtacaactac
     1441 aacagccaca acgtctatat catggccgac aagcagaaga acggcatcaa ggtgaacttc
     1501 aagatccgcc acaacatcga ggacggcagc gtgcagctcg ccgaccacta ccagcagaac
     1561 acccccatcg gcgacggccc cgtgctgctg cccgacaacc actacctgag cacccagtcc
     1621 gccctgagca aagaccccaa cgagaagcgc gatcacatgg tcctgctgga gttcgtgacc
     1681 gccgccggga tcactctcgg catggacgag ctgtacaagt aaagcggccg ctcgagtcta
     1741 gagggcccgt ttaaacccgc tgatcagcct cgactgtgcc ttctagttgc cagccatctg
     1801 ttgtttgccc ctcccccgtg ccttccttga ccctggaagg tgccactccc actgtccttt
     1861 cctaataaaa tgaggaaatt gcatcgcatt gtctgagtag gtgtcattct attctggggg
     1921 gtggggtggg gcaggacagc aagggggagg attgggaaga caatagcagg catgctgggg
     1981 atgcggtggg ctctatggct tctgaggcgg aaagaaccag ctggggctct agggggtatc
     2041 cccacgcgcc ctgtagcggc gcattaagcg cggcgggtgt ggtggttacg cgcagcgtga
     2101 ccgctacact tgccagcgcc ctagcgcccg ctcctttcgc tttcttccct tcctttctcg
     2161 ccacgttcgc cggctttccc cgtcaagctc taaatcgggg gctcccttta gggttccgat
     2221 ttagtgcttt acggcacctc gaccccaaaa aacttgatta gggtgatggt tcacgtagtg
     2281 ggccatcgcc ctgatagacg gtttttcgcc ctttgacgtt ggagtccacg ttctttaata
     2341 gtggactctt gttccaaact ggaacaacac tcaaccctat ctcggtctat tcttttgatt
     2401 tataagggat tttgccgatt tcggcctatt ggttaaaaaa tgagctgatt taacaaaaat
     2461 ttaacgcgaa ttaattctgt ggaatgtgtg tcagttaggg tgtggaaagt ccccaggctc
     2521 cccagcaggc agaagtatgc aaagcatgca tctcaattag tcagcaacca ggtgtggaaa
     2581 gtccccaggc tccccagcag gcagaagtat gcaaagcatg catctcaatt agtcagcaac
     2641 catagtcccg cccctaactc cgcccatccc gcccctaact ccgcccagtt ccgcccattc
     2701 tccgccccat ggctgactaa ttttttttat ttatgcagag gccgaggccg cctctgcctc
     2761 tgagctattc cagaagtagt gaggaggctt ttttggaggc ctaggctttt gcaaaaagct
     2821 cccgggagct tgtatatcca ttttcggatc tgatcaagag acaggatgag gatcgtttcg
     2881 catgattgaa caagatggat tgcacgcagg ttctccggcc gcttgggtgg agaggctatt
     2941 cggctatgac tgggcacaac agacaatcgg ctgctctgat gccgccgtgt tccggctgtc
     3001 agcgcagggg cgcccggttc tttttgtcaa gaccgacctg tccggtgccc tgaatgaact
     3061 gcaggacgag gcagcgcggc tatcgtggct ggccacgacg ggcgttcctt gcgcagctgt
     3121 gctcgacgtt gtcactgaag cgggaaggga ctggctgcta ttgggcgaag tgccggggca
     3181 ggatctcctg tcatctcacc ttgctcctgc cgagaaagta tccatcatgg ctgatgcaat
     3241 gcggcggctg catacgcttg atccggctac ctgcccattc gaccaccaag cgaaacatcg
     3301 catcgagcga gcacgtactc ggatggaagc cggtcttgtc gatcaggatg atctggacga
     3361 agagcatcag gggctcgcgc cagccgaact gttcgccagg ctcaaggcgc gcatgcccga
     3421 cggcgaggat ctcgtcgtga cccatggcga tgcctgcttg ccgaatatca tggtggaaaa
     3481 tggccgcttt tctggattca tcgactgtgg ccggctgggt gtggcggacc gctatcagga
     3541 catagcgttg gctacccgtg atattgctga agagcttggc ggcgaatggg ctgaccgctt
     3601 cctcgtgctt tacggtatcg ccgctcccga ttcgcagcgc atcgccttct atcgccttct
     3661 tgacgagttc ttctgagcgg gactctgggg ttcgaaatga ccgaccaagc gacgcccaac
     3721 ctgccatcac gagatttcga ttccaccgcc gccttctatg aaaggttggg cttcggaatc
     3781 gttttccggg acgccggctg gatgatcctc cagcgcgggg atctcatgct ggagttcttc
     3841 gcccacccca acttgtttat tgcagcttat aatggttaca aataaagcaa tagcatcaca
     3901 aatttcacaa ataaagcatt tttttcactg cattctagtt gtggtttgtc caaactcatc
     3961 aatgtatctt atcatgtctg tataccgtcg acctctagct agagcttggc gtaatcatgg
     4021 tcatagctgt ttcctgtgtg aaattgttat ccgctcacaa ttccacacaa catacgagcc
     4081 ggaagcataa agtgtaaagc ctggggtgcc taatgagtga gctaactcac attaattgcg
     4141 ttgcgctcac tgcccgcttt ccagtcggga aacctgtcgt gccagctgca ttaatgaatc
     4201 ggccaacgcg cggggagagg cggtttgcgt attgggcgct cttccgcttc ctcgctcact
     4261 gactcgctgc gctcggtcgt tcggctgcgg cgagcggtat cagctcactc aaaggcggta
     4321 atacggttat ccacagaatc aggggataac gcaggaaaga acatgtgagc aaaaggccag
     4381 caaaaggcca ggaaccgtaa aaaggccgcg ttgctggcgt ttttccatag gctccgcccc
     4441 cctgacgagc atcacaaaaa tcgacgctca agtcagaggt ggcgaaaccc gacaggacta
     4501 taaagatacc aggcgtttcc ccctggaagc tccctcgtgc gctctcctgt tccgaccctg
     4561 ccgcttaccg gatacctgtc cgcctttctc ccttcgggaa gcgtggcgct ttctcatagc
     4621 tcacgctgta ggtatctcag ttcggtgtag gtcgttcgct ccaagctggg ctgtgtgcac
     4681 gaaccccccg ttcagcccga ccgctgcgcc ttatccggta actatcgtct tgagtccaac
     4741 ccggtaagac acgacttatc gccactggca gcagccactg gtaacaggat tagcagagcg
     4801 aggtatgtag gcggtgctac agagttcttg aagtggtggc ctaactacgg ctacactaga
     4861 agaacagtat ttggtatctg cgctctgctg aagccagtta ccttcggaaa aagagttggt
     4921 agctcttgat ccggcaaaca aaccaccgct ggtagcggtt tttttgtttg caagcagcag
     4981 attacgcgca gaaaaaaagg atctcaagaa gatcctttga tcttttctac ggggtctgac
     5041 gctcagtgga acgaaaactc acgttaaggg attttggtca tgagattatc aaaaaggatc
     5101 ttcacctaga tccttttaaa ttaaaaatga agttttaaat caatctaaag tatatatgag
     5161 taaacttggt ctgacagtta ccaatgctta atcagtgagg cacctatctc agcgatctgt
     5221 ctatttcgtt catccatagt tgcctgactc cccgtcgtgt agataactac gatacgggag
     5281 ggcttaccat ctggccccag tgctgcaatg ataccgcgag acccacgctc accggctcca
     5341 gatttatcag caataaacca gccagccgga agggccgagc gcagaagtgg tcctgcaact
     5401 ttatccgcct ccatccagtc tattaattgt tgccgggaag ctagagtaag tagttcgcca
     5461 gttaatagtt tgcgcaacgt tgttgccatt gctacaggca tcgtggtgtc acgctcgtcg
     5521 tttggtatgg cttcattcag ctccggttcc caacgatcaa ggcgagttac atgatccccc
     5581 atgttgtgca aaaaagcggt tagctccttc ggtcctccga tcgttgtcag aagtaagttg
     5641 gccgcagtgt tatcactcat ggttatggca gcactgcata attctcttac tgtcatgcca
     5701 tccgtaagat gcttttctgt gactggtgag tactcaacca agtcattctg agaatagtgt
     5761 atgcggcgac cgagttgctc ttgcccggcg tcaatacggg ataataccgc gccacatagc
     5821 agaactttaa aagtgctcat cattggaaaa cgttcttcgg ggcgaaaact ctcaaggatc
     5881 ttaccgctgt tgagatccag ttcgatgtaa cccactcgtg cacccaactg atcttcagca
     5941 tcttttactt tcaccagcgt ttctgggtga gcaaaaacag gaaggcaaaa tgccgcaaaa
     6001 aagggaataa gggcgacacg gaaatgttga atactcatac tcttcctttt tcaatattat
     6061 tgaagcattt atcagggtta ttgtctcatg agcggataca tatttgaatg tatttagaaa
     6121 aataaacaaa taggggttcc gcgcacattt ccccgaaaag tgccacctga cgt


Product is for research use only!

No customer comments for the moment.

Add A Comment

Related Products


No products

Total $0.00

Prices don't include postage.
