pCDNA3.1- Myc- HisA (- )

$215.00

  • Model: PVT10684
  • 50 Units in Stock
Ask a question


Add to Cart:

pCDNA3.1-Myc-HisA(-)


Catalog No. PVT10684
Packing 2ug
Function Mammal expression plasmid
Resistance Amp
Screen Neo/G418
Strain DH5alpha
Culture temperature 37degrees centigrade
Replicon pUC
Copy high
Promoter CMV
Induction T7Fwd:5'd[TAATACGACTCACTATAGGG]3'
Forward primer
Reverse primer Screening markers: neomycin G418

No customer comments for the moment.

Add A Comment

Related Products

Cart  

No products

Total $0.00

Prices don't include postage.

Cart