pCDNA3.1(+)-2019-nCoV-S

$260.00

  • Model: PVT19760
  • 50 Units in Stock
Ask a question


Add to Cart:

pCDNA3.1(+)-2019-nCoV-S

PVT19760     2ug

 

pCDNA3.1(+)-2019-nCoV-S Information

Promoter: CMV

Replicator: PUC

Terminator: -

Plasmid size: 9239  bp

Prokaryotic resistance: Amp

Eukaryotic resistance: G418

Clone strain: DH5a

Culture condition: 37℃

Expression host: Mammalian cells

Culture conditions: 37 ℃, 5% CO2

Induction mode: no induction required

 

pCDNA3.1(+)-2019-nCoV-S Sequence

GACGGATCGGGAGATCTCCCGATCCCCTATGGTGCACTCTCAGTACAATCTGCTCTGATGCCGCATAGTTAAGCCAGTAT
CTGCTCCCTGCTTGTGTGTTGGAGGTCGCTGAGTAGTGCGCGAGCAAAATTTAAGCTACAACAAGGCAAGGCTTGACCGA
CAATTGCATGAAGAATCTGCTTAGGGTTAGGCGTTTTGCGCTGCTTCGCGATGTACGGGCCAGATATACGCGTTGACATT
GATTATTGACTAGTTATTAATAGTAATCAATTACGGGGTCATTAGTTCATAGCCCATATATGGAGTTCCGCGTTACATAA
CTTACGGTAAATGGCCCGCCTGGCTGACCGCCCAACGACCCCCGCCCATTGACGTCAATAATGACGTATGTTCCCATAGT
AACGCCAATAGGGACTTTCCATTGACGTCAATGGGTGGAGTATTTACGGTAAACTGCCCACTTGGCAGTACATCAAGTGT
ATCATATGCCAAGTACGCCCCCTATTGACGTCAATGACGGTAAATGGCCCGCCTGGCATTATGCCCAGTACATGACCTTA
TGGGACTTTCCTACTTGGCAGTACATCTACGTATTAGTCATCGCTATTACCATGGTGATGCGGTTTTGGCAGTACATCAA
TGGGCGTGGATAGCGGTTTGACTCACGGGGATTTCCAAGTCTCCACCCCATTGACGTCAATGGGAGTTTGTTTTGGCACC
AAAATCAACGGGACTTTCCAAAATGTCGTAACAACTCCGCCCCATTGACGCAAATGGGCGGTAGGCGTGTACGGTGGGAG
GTCTATATAAGCAGAGCTCTCTGGCTAACTAGAGAACCCACTGCTTACTGGCTTATCGAAATTAATACGACTCACTATAG
GGAGACCCAAGCTGGCTAGCGTTTAAACTTAAGCTTGGTACCGAGCTCGGATCCgccaccATGTTCGTGTTCCTCGTGCT
GCTCCCACTGGTGTCTAGCCAGTGCGTGAACCTCACCACCCGCACCCAGCTCCCTCCTGCCTACACAAACAGCTTCACAA
GGGGCGTGTACTACCCTGACAAGGTGTTCCGGTCTAGCGTGCTGCACTCTACACAGGACCTGTTCCTCCCTTTCTTCTCT
AACGTGACATGGTTCCACGCCATCCATGTATCCGGCACAAACGGCACAAAGCGGTTCGACAACCCCGTGCTCCCTTTCAA
CGACGGCGTGTACTTCGCCAGCACCGAGAAGTCTAACATTATTAGAGGCTGGATTTTCGGCACCACACTCGACTCTAAGA
CCCAGTCTCTCCTGATTGTGAACAACGCCACAAACGTGGTGATTAAGGTGTGCGAGTTCCAGTTCTGCAACGACCCTTTC
CTGGGCGTGTACTACCACAAGAACAACAAGTCTTGGATGGAGTCCGAGTTCCGGGTGTACTCTAGCGCCAACAACTGCAC
ATTCGAGTACGTGTCTCAGCCTTTCCTCATGGACCTGGAGGGCAAGCAGGGCAACTTCAAGAACCTGAGAGAGTTCGTGT
TCAAGAACATTGACGGCTACTTCAAGATTTACTCCAAGCACACCCCAATTAACCTGGTGAGGGACCTCCCTCAGGGCTTC
TCCGCCCTGGAACCCCTCGTGGACCTCCCAATTGGCATTAACATCACCCGGTTCCAGACACTGCTCGCCCTCCACCGGTC
TTACCTGACCCCAGGCGACTCTTCTAGCGGCTGGACAGCCGGCGCCGCCGCCTACTACGTGGGCTACCTCCAGCCACGCA
CATTCCTCCTGAAGTACAACGAGAACGGCACAATTACCGACGCCGTGGACTGCGCCCTCGACCCACTGAGCGAGACAAAG
TGCACACTGAAGTCTTTCACAGTGGAGAAGGGCATTTACCAGACATCTAACTTCCGGGTGCAGCCTACCGAGTCTATTGT
GCGGTTCCCAAACATTACCAACCTGTGCCCTTTCGGCGAGGTGTTCAACGCCACCCGCTTCGCCTCTGTGTACGCCTGGA
ACCGGAAGCGGATTTCTAACTGCGTGGCCGACTACTCTGTGCTGTACAACAGCGCCTCTTTCTCCACATTCAAGTGCTAC
GGCGTGTCCCCTACAAAGCTGAACGACCTGTGCTTCACAAACGTGTACGCCGACTCTTTCGTGATCCGGGGCGACGAGGT
GAGGCAGATTGCCCCAGGCCAGACAGGCAAGATTGCCGACTACAACTACAAGCTCCCTGACGACTTCACAGGCTGCGTGA
TCGCCTGGAACTCTAACAACCTCGACTCTAAGGTGGGCGGCAACTACAACTACCTGTACAGACTGTTCCGCAAGTCTAAC
CTGAAGCCTTTCGAGCGGGACATTAGCACCGAGATTTACCAGGCCGGCAGCACCCCATGCAACGGCGTGGAGGGCTTCAA
CTGCTACTTCCCACTCCAGTCTTACGGCTTCCAGCCTACAAACGGCGTGGGCTACCAGCCATACCGGGTGGTGGTGCTGT
CTTTTGAATTGCTCCACGCCCCCGCCACAGTGTGCGGCCCTAAGAAGTCCACAAACCTGGTGAAGAACAAGTGCGTGAAC
TTCAACTTCAACGGCCTCACAGGCACAGGCGTGCTCACCGAGTCCAACAAGAAGTTCCTGCCTTTCCAGCAGTTTGGCCG
GGACATTGCCGACACCACCGACGCCGTGAGGGACCCTCAGACATTGGAGATTCTGGACATCACCCCATGCAGCTTCGGCG
GCGTGTCTGTGATCACCCCCGGCACCAACACATCTAACCAGGTGGCCGTGCTGTACCAGGACGTGAACTGCACAGAGGTG
CCAGTGGCCATCCACGCCGACCAGCTGACCCCTACATGGAGGGTGTACTCTACAGGCTCTAACGTGTTCCAGACTCGCGC
CGGCTGCCTGATTGGCGCCGAGCACGTAAACAACAGCTACGAGTGCGACATCCCAATTGGCGCCGGCATTTGCGCCTCTT
ACCAGACCCAGACAAACTCTCCTAGACGGGCCCGGTCTGTGGCCTCTCAGTCTATTATTGCCTACACCATGTCCCTGGGC
GCCGAGAACTCTGTGGCCTACTCTAACAACTCTATTGCCATCCCTACAAACTTCACAATTTCTGTGACCACCGAGATTCT
CCCAGTGTCTATGACAAAGACATCCGTGGACTGCACCATGTACATTTGCGGCGACTCTACCGAGTGCTCTAACCTCCTGC
TCCAGTACGGCTCTTTCTGCACCCAGCTCAACCGGGCCCTCACAGGCATTGCCGTGGAGCAGGACAAGAACACACAGGAG
GTGTTCGCCCAGGTGAAGCAGATTTACAAGACCCCTCCTATTAAGGACTTCGGCGGCTTCAACTTCTCTCAGATTCTCCC
CGACCCTAGCAAGCCATCTAAGCGGTCCTTCATTGAGGACCTGCTGTTCAACAAGGTGACACTGGCCGACGCCGGCTTCA
TTAAGCAGTACGGCGACTGCCTGGGCGACATCGCCGCTCGTGACCTGATTTGCGCCCAGAAGTTCAACGGCCTGACAGTG
CTCCCCCCACTGCTCACCGACGAGATGATTGCCCAGTACACCAGCGCCCTCCTCGCCGGCACCATCACATCTGGCTGGAC
CTTCGGCGCCGGCGCCGCCCTACAGATCCCTTTCGCCATGCAGATGGCCTACCGCTTCAACGGCATCGGCGTGACCCAGA
ACGTGCTGTACGAGAACCAGAAGCTCATCGCCAACCAGTTCAACTCTGCCATTGGCAAGATTCAGGACTCTCTGTCTAGC
ACAGCCAGCGCCCTGGGCAAACTGCAAGACGTGGTGAACCAGAACGCCCAGGCCCTCAACACACTGGTGAAGCAACTCTC
GTCTAACTTCGGCGCCATTAGCTCTGTGCTGAACGACATTCTGTCCCGACTCGACAAGGTGGAGGCCGAGGTGCAGATTG
ACAGACTGATTACAGGCAGACTCCAATCTCTACAGACATACGTGACACAGCAGCTCATTAGAGCCGCCGAGATCAGAGCC
TCCGCCAACCTGGCCGCCACAAAGATGAGCGAGTGCGTGCTGGGCCAGTCCAAGAGAGTGGACTTCTGCGGCAAGGGCTA
CCACCTCATGTCTTTCCCTCAGTCCGCCCCTCACGGCGTGGTGTTCCTCCATGTTACATACGTGCCAGCCCAGGAGAAGA
ACTTCACCACAGCCCCCGCCATTTGCCACGACGGCAAGGCCCACTTCCCTAGAGAGGGCGTGTTCGTGTCCAACGGCACC
CACTGGTTCGTGACCCAGAGAAACTTCTACGAGCCTCAGATTATCACCACCGACAACACCTTCGTGTCTGGCAACTGCGA
CGTGGTGATTGGCATTGTGAACAACACAGTGTACGACCCATTGCAACCCGAACTTGACTCTTTCAAGGAGGAACTTGACA
AGTACTTCAAGAACCACACATCTCCCGACGTGGACCTGGGCGACATTAGCGGCATTAACGCCTCTGTGGTGAACATTCAG
AAGGAGATCGACAGGCTGAACGAGGTGGCCAAGAACCTGAACGAGTCTCTGATTGACTTGCAAGAGCTGGGCAAGTACGA
GCAGTACATTAAGTGGCCTTGGTACATTTGGCTGGGCTTCATCGCCGGCCTGATCGCCATTGTGATGGTGACCATCATGC
TGTGCTGCATGACATCTTGCTGCTCTTGCCTGAAGGGCTGCTGCTCTTGCGGCTCTTGCTGCAAGTTCGACGAGGACGAC
TCTGAGCCCGTGCTGAAGGGCGTGAAGCTCCACTACACATGAGAATTCTGCAGATATCCAGCACAGTGGCGGCCGCTCGA
GTCTAGAGGGCCCGTTTAAACCCGCTGATCAGCCTCGACTGTGCCTTCTAGTTGCCAGCCATCTGTTGTTTGCCCCTCCC
CCGTGCCTTCCTTGACCCTGGAAGGTGCCACTCCCACTGTCCTTTCCTAATAAAATGAGGAAATTGCATCGCATTGTCTG
AGTAGGTGTCATTCTATTCTGGGGGGTGGGGTGGGGCAGGACAGCAAGGGGGAGGATTGGGAAGACAATAGCAGGCATGC
TGGGGATGCGGTGGGCTCTATGGCTTCTGAGGCGGAAAGAACCAGCTGGGGCTCTAGGGGGTATCCCCACGCGCCCTGTA
GCGGCGCATTAAGCGCGGCGGGTGTGGTGGTTACGCGCAGCGTGACCGCTACACTTGCCAGCGCCCTAGCGCCCGCTCCT
TTCGCTTTCTTCCCTTCCTTTCTCGCCACGTTCGCCGGCTTTCCCCGTCAAGCTCTAAATCGGGGGCTCCCTTTAGGGTT
CCGATTTAGTGCTTTACGGCACCTCGACCCCAAAAAACTTGATTAGGGTGATGGTTCACGTAGTGGGCCATCGCCCTGAT
AGACGGTTTTTCGCCCTTTGACGTTGGAGTCCACGTTCTTTAATAGTGGACTCTTGTTCCAAACTGGAACAACACTCAAC
CCTATCTCGGTCTATTCTTTTGATTTATAAGGGATTTTGCCGATTTCGGCCTATTGGTTAAAAAATGAGCTGATTTAACA
AAAATTTAACGCGAATTAATTCTGTGGAATGTGTGTCAGTTAGGGTGTGGAAAGTCCCCAGGCTCCCCAGCAGGCAGAAG
TATGCAAAGCATGCATCTCAATTAGTCAGCAACCAGGTGTGGAAAGTCCCCAGGCTCCCCAGCAGGCAGAAGTATGCAAA
GCATGCATCTCAATTAGTCAGCAACCATAGTCCCGCCCCTAACTCCGCCCATCCCGCCCCTAACTCCGCCCAGTTCCGCC
CATTCTCCGCCCCATGGCTGACTAATTTTTTTTATTTATGCAGAGGCCGAGGCCGCCTCTGCCTCTGAGCTATTCCAGAA
GTAGTGAGGAGGCTTTTTTGGAGGCCTAGGCTTTTGCAAAAAGCTCCCGGGAGCTTGTATATCCATTTTCGGATCTGATC
AAGAGACAGGATGAGGATCGTTTCGCATGATTGAACAAGATGGATTGCACGCAGGTTCTCCGGCCGCTTGGGTGGAGAGG
CTATTCGGCTATGACTGGGCACAACAGACAATCGGCTGCTCTGATGCCGCCGTGTTCCGGCTGTCAGCGCAGGGGCGCCC
GGTTCTTTTTGTCAAGACCGACCTGTCCGGTGCCCTGAATGAACTGCAGGACGAGGCAGCGCGGCTATCGTGGCTGGCCA
CGACGGGCGTTCCTTGCGCAGCTGTGCTCGACGTTGTCACTGAAGCGGGAAGGGACTGGCTGCTATTGGGCGAAGTGCCG
GGGCAGGATCTCCTGTCATCTCACCTTGCTCCTGCCGAGAAAGTATCCATCATGGCTGATGCAATGCGGCGGCTGCATAC
GCTTGATCCGGCTACCTGCCCATTCGACCACCAAGCGAAACATCGCATCGAGCGAGCACGTACTCGGATGGAAGCCGGTC
TTGTCGATCAGGATGATCTGGACGAAGAGCATCAGGGGCTCGCGCCAGCCGAACTGTTCGCCAGGCTCAAGGCGCGCATG
CCCGACGGCGAGGATCTCGTCGTGACCCATGGCGATGCCTGCTTGCCGAATATCATGGTGGAAAATGGCCGCTTTTCTGG
ATTCATCGACTGTGGCCGGCTGGGTGTGGCGGACCGCTATCAGGACATAGCGTTGGCTACCCGTGATATTGCTGAAGAGC
TTGGCGGCGAATGGGCTGACCGCTTCCTCGTGCTTTACGGTATCGCCGCTCCCGATTCGCAGCGCATCGCCTTCTATCGC
CTTCTTGACGAGTTCTTCTGAGCGGGACTCTGGGGTTCGAAATGACCGACCAAGCGACGCCCAACCTGCCATCACGAGAT
TTCGATTCCACCGCCGCCTTCTATGAAAGGTTGGGCTTCGGAATCGTTTTCCGGGACGCCGGCTGGATGATCCTCCAGCG
CGGGGATCTCATGCTGGAGTTCTTCGCCCACCCCAACTTGTTTATTGCAGCTTATAATGGTTACAAATAAAGCAATAGCA
TCACAAATTTCACAAATAAAGCATTTTTTTCACTGCATTCTAGTTGTGGTTTGTCCAAACTCATCAATGTATCTTATCAT
GTCTGTATACCGTCGACCTCTAGCTAGAGCTTGGCGTAATCATGGTCATAGCTGTTTCCTGTGTGAAATTGTTATCCGCT
CACAATTCCACACAACATACGAGCCGGAAGCATAAAGTGTAAAGCCTGGGGTGCCTAATGAGTGAGCTAACTCACATTAA
TTGCGTTGCGCTCACTGCCCGCTTTCCAGTCGGGAAACCTGTCGTGCCAGCTGCATTAATGAATCGGCCAACGCGCGGGG
AGAGGCGGTTTGCGTATTGGGCGCTCTTCCGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGGCTGCGGCGAGC
GGTATCAGCTCACTCAAAGGCGGTAATACGGTTATCCACAGAATCAGGGGATAACGCAGGAAAGAACATGTGAGCAAAAG
GCCAGCAAAAGGCCAGGAACCGTAAAAAGGCCGCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCATCAC
AAAAATCGACGCTCAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAAGCTCCCT
CGTGCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGGAAGCGTGGCGCTTTCTC
ATAGCTCACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCTGGGCTGTGTGCACGAACCCCCCGTTCAG
CCCGACCGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTCCAACCCGGTAAGACACGACTTATCGCCACTGGCAGCAGC
CACTGGTAACAGGATTAGCAGAGCGAGGTATGTAGGCGGTGCTACAGAGTTCTTGAAGTGGTGGCCTAACTACGGCTACA
CTAGAAGAACAGTATTTGGTATCTGCGCTCTGCTGAAGCCAGTTACCTTCGGAAAAAGAGTTGGTAGCTCTTGATCCGGC
AAACAAACCACCGCTGGTAGCGGTTTTTTTGTTTGCAAGCAGCAGATTACGCGCAGAAAAAAAGGATCTCAAGAAGATCC
TTTGATCTTTTCTACGGGGTCTGACGCTCAGTGGAACGAAAACTCACGTTAAGGGATTTTGGTCATGAGATTATCAAAAA
GGATCTTCACCTAGATCCTTTTAAATTAAAAATGAAGTTTTAAATCAATCTAAAGTATATATGAGTAAACTTGGTCTGAC
AGTTACCAATGCTTAATCAGTGAGGCACCTATCTCAGCGATCTGTCTATTTCGTTCATCCATAGTTGCCTGACTCCCCGT
CGTGTAGATAACTACGATACGGGAGGGCTTACCATCTGGCCCCAGTGCTGCAATGATACCGCGAGACCCACGCTCACCGG
CTCCAGATTTATCAGCAATAAACCAGCCAGCCGGAAGGGCCGAGCGCAGAAGTGGTCCTGCAACTTTATCCGCCTCCATC
CAGTCTATTAATTGTTGCCGGGAAGCTAGAGTAAGTAGTTCGCCAGTTAATAGTTTGCGCAACGTTGTTGCCATTGCTAC
AGGCATCGTGGTGTCACGCTCGTCGTTTGGTATGGCTTCATTCAGCTCCGGTTCCCAACGATCAAGGCGAGTTACATGAT
CCCCCATGTTGTGCAAAAAAGCGGTTAGCTCCTTCGGTCCTCCGATCGTTGTCAGAAGTAAGTTGGCCGCAGTGTTATCA
CTCATGGTTATGGCAGCACTGCATAATTCTCTTACTGTCATGCCATCCGTAAGATGCTTTTCTGTGACTGGTGAGTACTC
AACCAAGTCATTCTGAGAATAGTGTATGCGGCGACCGAGTTGCTCTTGCCCGGCGTCAATACGGGATAATACCGCGCCAC
ATAGCAGAACTTTAAAAGTGCTCATCATTGGAAAACGTTCTTCGGGGCGAAAACTCTCAAGGATCTTACCGCTGTTGAGA
TCCAGTTCGATGTAACCCACTCGTGCACCCAACTGATCTTCAGCATCTTTTACTTTCACCAGCGTTTCTGGGTGAGCAAA
AACAGGAAGGCAAAATGCCGCAAAAAAGGGAATAAGGGCGACACGGAAATGTTGAATACTCATACTCTTCCTTTTTCAAT
ATTATTGAAGCATTTATCAGGGTTATTGTCTCATGAGCGGATACATATTTGAATGTATTTAGAAAAATAAACAAATAGGG
GTTCCGCGCACATTTCCCCGAAAAGTGCCACCTGACGTC
//

Caution:
Product is for research use only!

 

No customer comments for the moment.

Add A Comment

Related Products

Cart  

No products

Total $0.00

Prices don't include postage.

Cart