pcDNA3.1-3xFlag-C

$280.00

  • Model: PVTY00001
  • 20 Units in Stock
Ask a question


Add to Cart:

pcDNA3.1-3xFlag-C

PVTY00001  2ug

pcDNA3.1-3xFlag-C Description

Plasmid type: Mammalian expression vector Size: 5496 bp 5' sequencing primers: CMV-F:CTAGAGAACCCACTGCTTAC 3' sequencing primers: BGH-R:TAGAAGGCACAGTCGAGG Resistance(s): Ampicillin (Amp) Selectable markers: G418 Tags: 3xFlag

Caution:
1.  This product is FOR RESEARCH USE ONLY!

No customer comments for the moment.

Add A Comment

Related Products

Cart  

No products

Total $0.00

Prices don't include postage.

Cart