pcDNA3.1/His A

$280.00

  • Model: PVTY00942
  • 20 Units in Stock
Ask a question


Add to Cart:

pcDNA3.1/His A

PVTY00942  2ug

pcDNA3.1/His A Description

Plasmid type: Mammalian cell expression vector Promoter: CMV Copy number: High copy Cloning Method: Multiple cloning sites,restriction endonuclease Size: 5514 bp 5' sequencing primers:?? pcDNA3.1-F:CTAGAGAACCCACTGCTTAC 3' sequencing primers:?? pcDNA3.1-R (BGH-R):TAGAAGGCACAGTCGAGG Tags: N-His, N-EK Resistance(s): Ampicillin (Amp) Selectable markers: Neomycin (G418)

Caution:
1.  This product is FOR RESEARCH USE ONLY!

No customer comments for the moment.

Add A Comment

Related Products

Cart  

No products

Total $0.00

Prices don't include postage.

Cart