pcDNA3.1(+)/myc-His A

$280.00

  • Model: PVTY00935
  • 20 Units in Stock
Ask a question


Add to Cart:

pcDNA3.1(+)/myc-His A

PVTY00935  2ug

pcDNA3.1(+)/myc-His A Description

Alias: pcDNA3.1/myc-His A Plasmid type: Mammalian expression vector Copy number: High copy Promoter: CMV Size: 5493 bp 5' Sequencing primers and sequences: T7 Fwd:5'd[TAATACGACTCACTATAGGG]3' Tags: 6X His, myc Resistance(s): Ampicillin (Amp) Selectable markers: Neomycin (Neomycin)

Caution:
1.  This product is FOR RESEARCH USE ONLY!

No customer comments for the moment.

Add A Comment

Related Products

Cart  

No products

Total $0.00

Prices don't include postage.

Cart