pcDNA3.1-Puro-3Flag-2019-nCoV-N

$260.00

  • Model: PVT19766
  • 50 Units in Stock
Ask a question


Add to Cart:

pcDNA3.1-Puro-3Flag-2019-nCoV-N

PVT19766     2ug

 

pcDNA3.1-Puro-3Flag-2019-nCoV-N Information

Vector Size: 9038 bp
Vector type:Mammalian Expression
Selectable markers:Puromycin
Bacterial Resistance(s): Ampicillin
Growth Temperature: 37°C

 

pcDNA3.1-Puro-3Flag-2019-nCoV-N Sequence

GACGGATCGGGAGATCTCCCGATCCCCTATGGTGCACTCTCAGTACAATCTGCTCTGATGCCGCATAGTTAAGCCAGTAT
CTGCTCCCTGCTTGTGTGTTGGAGGTCGCTGAGTAGTGCGCGAGCAAAATTTAAGCTACAACAAGGCAAGGCTTGACCGA
CAATTGCATGAAGAATCTGCTTAGGGTTAGGCGTTTTGCGCTGCTTCGCGATGTACGGGCCAGATATACGCGTTGACATT
GATTATTGACTAGTTATTAATAGTAATCAATTACGGGGTCATTAGTTCATAGCCCATATATGGAGTTCCGCGTTACATAA
CTTACGGTAAATGGCCCGCCTGGCTGACCGCCCAACGACCCCCGCCCATTGACGTCAATAATGACGTATGTTCCCATAGT
AACGCCAATAGGGACTTTCCATTGACGTCAATGGGTGGAGTATTTACGGTAAACTGCCCACTTGGCAGTACATCAAGTGT
ATCATATGCCAAGTACGCCCCCTATTGACGTCAATGACGGTAAATGGCCCGCCTGGCATTATGCCCAGTACATGACCTTA
TGGGACTTTCCTACTTGGCAGTACATCTACGTATTAGTCATCGCTATTACCATGGTGATGCGGTTTTGGCAGTACATCAA
TGGGCGTGGATAGCGGTTTGACTCACGGGGATTTCCAAGTCTCCACCCCATTGACGTCAATGGGAGTTTGTTTTGGCACC
AAAATCAACGGGACTTTCCAAAATGTCGTAACAACTCCGCCCCATTGACGCAAATGGGCGGTAGGCGTGTACGGTGGGAG
GTCTATATAAGCAGAGCTCTCTGGCTAACTAGAGAACCCACTGCTTACTGGCTTATCGAAATTAATACGACTCACTATAG
GGAGACCCAAGCTGGCTAGCgccaccatggactacaaagaccatgacggtgattataaagatcatgacatcgattacaag
gatgacgatgacaagcttTCTAGAGAATTCgatatcGGATCCgccaccATGTTCGTGTTCCTCGTGCTGCTCCCACTGGT
GTCTAGCCAGTGCGTGAACCTCACCACCCGCACCCAGCTCCCTCCTGCCTACACAAACAGCTTCACAAGGGGCGTGTACT
ACCCTGACAAGGTGTTCCGGTCTAGCGTGCTGCACTCTACACAGGACCTGTTCCTCCCTTTCTTCTCTAACGTGACATGG
TTCCACGCCATCCATGTATCCGGCACAAACGGCACAAAGCGGTTCGACAACCCCGTGCTCCCTTTCAACGACGGCGTGTA
CTTCGCCAGCACCGAGAAGTCTAACATTATTAGAGGCTGGATTTTCGGCACCACACTCGACTCTAAGACCCAGTCTCTCC
TGATTGTGAACAACGCCACAAACGTGGTGATTAAGGTGTGCGAGTTCCAGTTCTGCAACGACCCTTTCCTGGGCGTGTAC
TACCACAAGAACAACAAGTCTTGGATGGAGTCCGAGTTCCGGGTGTACTCTAGCGCCAACAACTGCACATTCGAGTACGT
GTCTCAGCCTTTCCTCATGGACCTGGAGGGCAAGCAGGGCAACTTCAAGAACCTGAGAGAGTTCGTGTTCAAGAACATTG
ACGGCTACTTCAAGATTTACTCCAAGCACACCCCAATTAACCTGGTGAGGGACCTCCCTCAGGGCTTCTCCGCCCTGGAA
CCCCTCGTGGACCTCCCAATTGGCATTAACATCACCCGGTTCCAGACACTGCTCGCCCTCCACCGGTCTTACCTGACCCC
AGGCGACTCTTCTAGCGGCTGGACAGCCGGCGCCGCCGCCTACTACGTGGGCTACCTCCAGCCACGCACATTCCTCCTGA
AGTACAACGAGAACGGCACAATTACCGACGCCGTGGACTGCGCCCTCGACCCACTGAGCGAGACAAAGTGCACACTGAAG
TCTTTCACAGTGGAGAAGGGCATTTACCAGACATCTAACTTCCGGGTGCAGCCTACCGAGTCTATTGTGCGGTTCCCAAA
CATTACCAACCTGTGCCCTTTCGGCGAGGTGTTCAACGCCACCCGCTTCGCCTCTGTGTACGCCTGGAACCGGAAGCGGA
TTTCTAACTGCGTGGCCGACTACTCTGTGCTGTACAACAGCGCCTCTTTCTCCACATTCAAGTGCTACGGCGTGTCCCCT
ACAAAGCTGAACGACCTGTGCTTCACAAACGTGTACGCCGACTCTTTCGTGATCCGGGGCGACGAGGTGAGGCAGATTGC
CCCAGGCCAGACAGGCAAGATTGCCGACTACAACTACAAGCTCCCTGACGACTTCACAGGCTGCGTGATCGCCTGGAACT
CTAACAACCTCGACTCTAAGGTGGGCGGCAACTACAACTACCTGTACAGACTGTTCCGCAAGTCTAACCTGAAGCCTTTC
GAGCGGGACATTAGCACCGAGATTTACCAGGCCGGCAGCACCCCATGCAACGGCGTGGAGGGCTTCAACTGCTACTTCCC
ACTCCAGTCTTACGGCTTCCAGCCTACAAACGGCGTGGGCTACCAGCCATACCGGGTGGTGGTGCTGTCTTTTGAATTGC
TCCACGCCCCCGCCACAGTGTGCGGCCCTAAGAAGTCCACAAACCTGGTGAAGAACAAGTGCGTGAACTTCAACTTCAAC
GGCCTCACAGGCACAGGCGTGCTCACCGAGTCCAACAAGAAGTTCCTGCCTTTCCAGCAGTTTGGCCGGGACATTGCCGA
CACCACCGACGCCGTGAGGGACCCTCAGACATTGGAGATTCTGGACATCACCCCATGCAGCTTCGGCGGCGTGTCTGTGA
TCACCCCCGGCACCAACACATCTAACCAGGTGGCCGTGCTGTACCAGGACGTGAACTGCACAGAGGTGCCAGTGGCCATC
CACGCCGACCAGCTGACCCCTACATGGAGGGTGTACTCTACAGGCTCTAACGTGTTCCAGACTCGCGCCGGCTGCCTGAT
TGGCGCCGAGCACGTAAACAACAGCTACGAGTGCGACATCCCAATTGGCGCCGGCATTTGCGCCTCTTACCAGACCCAGA
CAAACTCTCCTAGACGGGCCCGGTCTGTGGCCTCTCAGTCTATTATTGCCTACACCATGTCCCTGGGCGCCGAGAACTCT
GTGGCCTACTCTAACAACTCTATTGCCATCCCTACAAACTTCACAATTTCTGTGACCACCGAGATTCTCCCAGTGTCTAT
GACAAAGACATCCGTGGACTGCACCATGTACATTTGCGGCGACTCTACCGAGTGCTCTAACCTCCTGCTCCAGTACGGCT
CTTTCTGCACCCAGCTCAACCGGGCCCTCACAGGCATTGCCGTGGAGCAGGACAAGAACACACAGGAGGTGTTCGCCCAG
GTGAAGCAGATTTACAAGACCCCTCCTATTAAGGACTTCGGCGGCTTCAACTTCTCTCAGATTCTCCCCGACCCTAGCAA
GCCATCTAAGCGGTCCTTCATTGAGGACCTGCTGTTCAACAAGGTGACACTGGCCGACGCCGGCTTCATTAAGCAGTACG
GCGACTGCCTGGGCGACATCGCCGCTCGTGACCTGATTTGCGCCCAGAAGTTCAACGGCCTGACAGTGCTCCCCCCACTG
CTCACCGACGAGATGATTGCCCAGTACACCAGCGCCCTCCTCGCCGGCACCATCACATCTGGCTGGACCTTCGGCGCCGG
CGCCGCCCTACAGATCCCTTTCGCCATGCAGATGGCCTACCGCTTCAACGGCATCGGCGTGACCCAGAACGTGCTGTACG
AGAACCAGAAGCTCATCGCCAACCAGTTCAACTCTGCCATTGGCAAGATTCAGGACTCTCTGTCTAGCACAGCCAGCGCC
CTGGGCAAACTGCAAGACGTGGTGAACCAGAACGCCCAGGCCCTCAACACACTGGTGAAGCAACTCTCGTCTAACTTCGG
CGCCATTAGCTCTGTGCTGAACGACATTCTGTCCCGACTCGACAAGGTGGAGGCCGAGGTGCAGATTGACAGACTGATTA
CAGGCAGACTCCAATCTCTACAGACATACGTGACACAGCAGCTCATTAGAGCCGCCGAGATCAGAGCCTCCGCCAACCTG
GCCGCCACAAAGATGAGCGAGTGCGTGCTGGGCCAGTCCAAGAGAGTGGACTTCTGCGGCAAGGGCTACCACCTCATGTC
TTTCCCTCAGTCCGCCCCTCACGGCGTGGTGTTCCTCCATGTTACATACGTGCCAGCCCAGGAGAAGAACTTCACCACAG
CCCCCGCCATTTGCCACGACGGCAAGGCCCACTTCCCTAGAGAGGGCGTGTTCGTGTCCAACGGCACCCACTGGTTCGTG
ACCCAGAGAAACTTCTACGAGCCTCAGATTATCACCACCGACAACACCTTCGTGTCTGGCAACTGCGACGTGGTGATTGG
CATTGTGAACAACACAGTGTACGACCCATTGCAACCCGAACTTGACTCTTTCAAGGAGGAACTTGACAAGTACTTCAAGA
ACCACACATCTCCCGACGTGGACCTGGGCGACATTAGCGGCATTAACGCCTCTGTGGTGAACATTCAGAAGGAGATCGAC
AGGCTGAACGAGGTGGCCAAGAACCTGAACGAGTCTCTGATTGACTTGCAAGAGCTGGGCAAGTACGAGCAGTACATTAA
GTGGCCTTGGTACATTTGGCTGGGCTTCATCGCCGGCCTGATCGCCATTGTGATGGTGACCATCATGCTGTGCTGCATGA
CATCTTGCTGCTCTTGCCTGAAGGGCTGCTGCTCTTGCGGCTCTTGCTGCAAGTTCGACGAGGACGACTCTGAGCCCGTG
CTGAAGGGCGTGAAGCTCCACTACACATGAGAATTCTGCAGATATCCAGCACAGTGGCGGCCGCTCGAGACCGGTaAGTT
TAAACCGCTGATCAGCCTCGACTGTGCCTTCTAGTTGCCAGCCATCTGTTGTTTGCCCCTCCCCCGTGCCTTCCTTGACC
CTGGAAGGTGCCACTCCCACTGTCCTTTCCTAATAAAATGAGGAAATTGCATCGCATTGTCTGAGTAGGTGTCATTCTAT
TCTGGGGGGTGGGGTGGGGCAGGACAGCAAGGGGGAGGATTGGGAAGACAATAGCAGGCATGCTGGGGATGCGGTGGGCT
CTATGGCTTCTGAGGCGGAAAGAACCAGCTGGGGCTCTAGGGGGTATCCCCACGCGCCCTGTAGCGGCGCATTAAGCGCG
GCGGGTGTGGTGGTTACGCGCAGCGTGACCGCTACACTTGCCAGCGCCCTAGCGCCCGCTCCTTTCGCTTTCTTCCCTTC
CTTTCTCGCCACGTTCGCCGGCTTTCCCCGTCAAGCTCTAAATCGGGGGCTCCCTTTAGGGTTCCGATTTAGTGCTTTAC
GGCACCTCGACCCCAAAAAACTTGATTAGGGTGATGGTTCACGTAGTGGGCCATCGCCCTGATAGACGGTTTTTCGCCCT
TTGACGTTGGAGTCCACGTTCTTTAATAGTGGACTCTTGTTCCAAACTGGAACAACACTCAACCCTATCTCGGTCTATTC
TTTTGATTTATAAGGGATTTTGGCCATTTCGGCCTATTGGTTAAAAAATGAGCTGATTTAACAAAAATTTAACGCGAATT
AATTCTGTGGAATGTGTGTCAGTTAGGGTGTGGAAAGTCCCCAGGCTCCCCAGCAGGCAGAAGTATGCAAAGCATGCATC
TCAATTAGTCAGCAACCAGGTGTGGAAAGTCCCCAGGCTCCCCAGCAGGCAGAAGTATGCAAAGCATGCATCTCAATTAG
TCAGCAACCATAGTCCCGCCCCTAACTCCGCCCATCCCGCCCCTAACTCCGCCCAGTTCCGCCCATTCTCCGCCCCATGG
CTGACTAATTTTTTTTATTTATGCAGAGGCCGAGGCCGCCTCTGCCTCTGAGCTATTCCAGAAGTAGTGAGGAGGCTTTT
TTGGAGGCCTAGGCTTTTGCAAAAAGCTCCCgggatgaccgagtacaagcccacggtgcgcctcgccacccgcgacgacg
tccccagggccgtacgcaccctcgccgccgcgttcgccgactaccccgccacgcgccacaccgtcgatccggaccgccac
atcgagcgggtcaccgagctgcaagaactcttcctcacgcgcgtcgggctcgacatcggcaaggtgtgggtcgcggacga
cggcgccgcggtggcggtctggaccacgccggagagcgtcgaagcgggggcggtgttcgccgagatcggcccgcgcatgg
ccgagttgagcggttcccggctggccgcgcagcaacagatggaaggcctcctggcgccgcaccggcccaaggagcccgcg
tggttcctggccaccgtcggcgtctcgcccgaccaccagggcaagggtctgggcagcgccgtcgtgctccccggagtgga
ggcggccgagcgcgccggggtgcccgccttcctggagacctccgcgccccgcaacctccccttctacgagcggctcggct
tcaccgtcaccgccgacgtcgaggtgcccgaaggaccgcgcacctggtgcatgacccgcaagcccggtgcctgaTTCGAA
ATGACCGACCAAGCGACGCCCAACCTGCCATCACGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGGTTGGGCTTCGG
AATCGTTTTCCGGGACGCCGGCTGGATGATCCTCCAGCGCGGGGATCTCATGCTGGAGTTCTTCGCCCACCCCAACTTGT
TTATTGCAGCTTATAATGGTTACAAATAAAGCAATAGCATCACAAATTTCACAAATAAAGCATTTTTTTCACTGCATTCT
AGTTGTGGTTTGTCCAAACTCATCAATGTATCTTATCATGTCTGTATACCGTCGACCTCTAGCTAGAGCTTGGCGTAATC
ATGGTCATAGCTGTTTCCTGTGTGAAATTGTTATCCGCTCACAATTCCACACAACATACGAGCCGGAAGCATAAAGTGTA
AAGCCTGGGGTGCCTAATGAGTGAGCTAACTCACATTAATTGCGTTGCGCTCACTGCCCGCTTTCCAGTCGGGAAACCTG
TCGTGCCAGCTGCATTAATGAATCGGCCAACGCGCGGGGAGAGGCGGTTTGCGTATTGGGCGCTCTTCCGCTTCCTCGCT
CACTGACTCGCTGCGCTCGGTCGTTCGGCTGCGGCGAGCGGTATCAGCTCACTCAAAGGCGGTAATACGGTTATCCACAG
AATCAGGGGATAACGCAGGAAAGAACATGTGAGCAAAAGGCCAGCAAAAGGCCAGGAACCGTAAAAAGGCCGCGTTGCTG
GCGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGACGCTCAAGTCAGAGGTGGCGAAACCCGACAGG
ACTATAAAGATACCAGGCGTTTCCCCCTGGAAGCTCCCTCGTGCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACC
TGTCCGCCTTTCTCCCTTCGGGAAGCGTGGCGCTTTCTCATAGCTCACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTT
CGCTCCAAGCTGGGCTGTGTGCACGAACCCCCCGTTCAGCCCGACCGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTC
CAACCCGGTAAGACACGACTTATCGCCACTGGCAGCAGCCACTGGTAACAGGATTAGCAGAGCGAGGTATGTAGGCGGTG
CTACAGAGTTCTTGAAGTGGTGGCCTAACTACGGCTACACTAGAAGAACAGTATTTGGTATCTGCGCTCTGCTGAAGCCA
GTTACCTTCGGAAAAAGAGTTGGTAGCTCTTGATCCGGCAAACAAACCACCGCTGGTAGCGGTTTTTTTGTTTGCAAGCA
GCAGATTACGCGCAGAAAAAAAGGATCTCAAGAAGATCCTTTGATCTTTTCTACGGGGTCTGACGCTCAGTGGAACGAAA
ACTCACGTTAAGGGATTTTGGTCATGAGATTATCAAAAAGGATCTTCACCTAGATCCTTTTAAATTAAAAATGAAGTTTT
AAATCAATCTAAAGTATATATGAGTAAACTTGGTCTGACAGTTACCAATGCTTAATCAGTGAGGCACCTATCTCAGCGAT
CTGTCTATTTCGTTCATCCATAGTTGCCTGACTCCCCGTCGTGTAGATAACTACGATACGGGAGGGCTTACCATCTGGCC
CCAGTGCTGCAATGATACCGCGAGACCCACGCTCACCGGCTCCAGATTTATCAGCAATAAACCAGCCAGCCGGAAGGGCC
GAGCGCAGAAGTGGTCCTGCAACTTTATCCGCCTCCATCCAGTCTATTAATTGTTGCCGGGAAGCTAGAGTAAGTAGTTC
GCCAGTTAATAGTTTGCGCAACGTTGTTGCCATTGCTACAGGCATCGTGGTGTCACGCTCGTCGTTTGGTATGGCTTCAT
TCAGCTCCGGTTCCCAACGATCAAGGCGAGTTACATGATCCCCCATGTTGTGCAAAAAAGCGGTTAGCTCCTTCGGTCCT
CCGATCGTTGTCAGAAGTAAGTTGGCCGCAGTGTTATCACTCATGGTTATGGCAGCACTGCATAATTCTCTTACTGTCAT
GCCATCCGTAAGATGCTTTTCTGTGACTGGTGAGTACTCAACCAAGTCATTCTGAGAATAGTGTATGCGGCGACCGAGTT
GCTCTTGCCCGGCGTCAATACGGGATAATACCGCGCCACATAGCAGAACTTTAAAAGTGCTCATCATTGGAAAACGTTCT
TCGGGGCGAAAACTCTCAAGGATCTTACCGCTGTTGAGATCCAGTTCGATGTAACCCACTCGTGCACCCAACTGATCTTC
AGCATCTTTTACTTTCACCAGCGTTTCTGGGTGAGCAAAAACAGGAAGGCAAAATGCCGCAAAAAAGGGAATAAGGGCGA
CACGGAAATGTTGAATACTCATACTCTTCCTTTTTCAATATTATTGAAGCATTTATCAGGGTTATTGTCTCATGAGCGGA
TACATATTTGAATGTATTTAGAAAAATAAACAAATAGGGGTTCCGCGCACATTTCCCCGAAAAGTGCCACCTGACGTC

//
 

Caution:
Product is for research use only!

No customer comments for the moment.

Add A Comment

Related Products

Cart  

No products

Total $0.00

Prices don't include postage.

Cart