pcDNA3-CFP

$280.00

  • Model: PVTY00404
  • 20 Units in Stock
Ask a question


Add to Cart:

pcDNA3-CFP

PVTY00404  2ug

pcDNA3-CFP Description

Plasmid type: Mammalian expression vector Size: 6160 bp Cloning Method: Multiple cloning sites,restriction endonuclease 5'Sequencing primers T7 3'Sequencing primers GTCTTGTAGTTGCCGTCGTC Resistance(s): Ampicillin(Amp) Selectable markers: Neomycin
No customer comments for the moment.

Add A Comment

Related Products

Cart  

No products

Total $0.00

Prices don't include postage.

Cart