pcDNA-DEST40

$280.00

  • Model: PVTY00783
  • 20 Units in Stock
Ask a question


Add to Cart:

pcDNA-DEST40

PVTY00783  2ug

pcDNA-DEST40 Description

Plasmid type: Gateway vector Promoter: CMV Cloning Method: Multiple cloning sites,restriction endonuclease Size: 7143bp 5' Sequencing primers and sequences: T7 Fwd:?5'd[TAATACGACTCACTATAGGG]3' Tags: V5 Resistance(s): Ampicillin (Amp)

Caution:
1.  This product is FOR RESEARCH USE ONLY!

No customer comments for the moment.

Add A Comment

Related Products

Cart  

No products

Total $0.00

Prices don't include postage.

Cart