pCEP4 Plasmid


  • Model: PVT1037
  • 50 Units in Stock
Ask a question

Add to Cart:

pCEP4 Plasmid

PVT1037       2ug


pCEP4 Plasmid Information

Promoter: CMV

Replicator: PUC

Terminator: SV40 poly (a) signal

Plasmid size: 10186bp

Prokaryotic resistance: amp

Eukaryotic resistance: hyg

Clone strain: dh5a

Culture condition: 37 degrees

Expression host: 293T and other mammalian cells

Induction mode: no induction, instantaneous expression


3 'sequencing primer: Sv40-polyA-R:GAAATTTGTGATGCTATTGC

Plasmid host: mammalian cell

Purpose of plasmid: protein expression

Fragment type: ORF

Fragment species: empty body

Prokaryotic resistance: amp

Eukaryotic resistance: hyg


pCEP4 Plasmid Description

 pCEP4 is an episomal mammalian expression vector that uses thecytomegalovirus (CMV) immediate early enhancer/promoter for high level transcription of recombinant genes inserted into the multiple cloning site. The Epstein-Barr Virus replication origin (oriP) and nuclear antigen (encoded by the EBNA-1 gene) is carried by this plasmid to permit extrachromosomal replication in human, primate, and canine cells. pCEP4 also carries the hygromycin B resistance gene for stable selection in transfected cells.
       pCEP4/CAT is provided as a positive control for the relative level of expression of recombinant proteins in a cell line of interest. It expresses the chloramphenicol acetyl transferase (CAT) protein from the CMV enhancer/promoter. Like its parent vector pCEP4, pCEP4/CAT contains the hygromycin B resistance gene for selection.


pCEP4 Plasmid Multiple Cloning site



pCEP4 Plasmid  Sequence

LOCUS       Exported               10186 bp ds-DNA     circular SYN 22-AUG-2016

DEFINITION  synthetic circular DNA

KEYWORDS    Untitled

SOURCE      synthetic DNA construct

  ORGANISM  synthetic DNA construct

REFERENCE   1  (bases 1 to 10186)

  TITLE     Direct Submission

FEATURES             Location/Qualifiers

     source          1..10186

                     /organism="synthetic DNA construct"

                     /mol_type="other DNA"

     enhancer        4..383

                     /note="CMV enhancer"

                     /note="human cytomegalovirus immediate early enhancer"

     promoter        384..587

                     /note="CMV promoter"

                     /note="human cytomegalovirus (CMV) immediate early 


     polyA_signal    672..806

                     /note="SV40 poly(A) signal"

                     /note="SV40 polyadenylation signal"

     rep_origin      1529..3318


                     /note="Epstein-Barr virus oriP replication origin (Yates et

                     al., 2000)"

     promoter        6066..6170


                     /note="AmpR promoter"

     CDS             6171..7031





                     /note="confers resistance to ampicillin, carbenicillin, and

                     related antibiotics"







     rep_origin      7202..7790



                     /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of 


     promoter        8221..8366

                     /note="HSV TK promoter"

                     /note="herpes simplex virus thymidine kinase promoter"

     CDS             8409..9446


                     /product="hygromycin B phosphotransferase"


                     /note="confers resistance to hygromycin"








     polyA_signal    9488..9536

                     /note="HSV TK poly(A) signal"

                     /note="herpes simplex virus thymidine kinase 

                     polyadenylation signal (Cole and Stacy, 1985)"


        1 gttgacattg attattgact agttattaat agtaatcaat tacggggtca ttagttcata

       61 gcccatatat ggagttccgc gttacataac ttacggtaaa tggcccgcct ggctgaccgc

      121 ccaacgaccc ccgcccattg acgtcaataa tgacgtatgt tcccatagta acgccaatag

      181 ggactttcca ttgacgtcaa tgggtggagt atttacggta aactgcccac ttggcagtac

      241 atcaagtgta tcatatgcca agtccgcccc ctattgacgt caatgacggt aaatggcccg

      301 cctggcatta tgcccagtac atgaccttac gggactttcc tacttggcag tacatctacg

      361 tattagtcat cgctattacc atggtgatgc ggttttggca gtacaccaat gggcgtggat

      421 agcggtttga ctcacgggga tttccaagtc tccaccccat tgacgtcaat gggagtttgt

      481 tttggcacca aaatcaacgg gactttccaa aatgtcgtaa taaccccgcc ccgttgacgc

      541 aaatgggcgg taggcgtgta cggtgggagg tctatataag cagagctcgt ttagtgaacc

      601 gtcagatctc tagaagctgg gtaccagctg ctagcaagct tgctagcggc cgctcgaggc

      661 cggcaaggcc ggatccagac atgataagat acattgatga gtttggacaa accacaacta

      721 gaatgcagtg aaaaaaatgc tttatttgtg aaatttgtga tgctattgct ttatttgtaa

      781 ccattataag ctgcaataaa caagttaaca acaacaattg cattcatttt atgtttcagg

      841 ttcaggggga ggtgtgggag gttttttaaa gcaagtaaaa cctctacaaa tgtggtatgg

      901 ctgattatga tccggctgcc tcgcgcgttt cggtgatgac ggtgaaaacc tctgacacat

      961 gcagctcccg gagacggtca cagcttgtct gtaagcggat gccgggagca gacaagcccg

     1021 tcaggcgtca gcgggtgttg gcgggtgtcg gggcgcagcc atgaggtcga ctctagagga

     1081 tcgatgcccc gccccggacg aactaaacct gactacgaca tctctgcccc ttcttcgcgg

     1141 ggcagtgcat gtaatccctt cagttggttg gtacaacttg ccaactgggc cctgttccac

     1201 atgtgacacg gggggggacc aaacacaaag gggttctctg actgtagttg acatccttat

     1261 aaatggatgt gcacatttgc caacactgag tggctttcat cctggagcag actttgcagt

     1321 ctgtggactg caacacaaca ttgcctttat gtgtaactct tggctgaagc tcttacacca

     1381 atgctggggg acatgtacct cccaggggcc caggaagact acgggaggct acaccaacgt

     1441 caatcagagg ggcctgtgta gctaccgata agcggaccct caagagggca ttagcaatag

     1501 tgtttataag gcccccttgt taaccctaaa cgggtagcat atgcttcccg ggtagtagta

     1561 tatactatcc agactaaccc taattcaata gcatatgtta cccaacggga agcatatgct

     1621 atcgaattag ggttagtaaa agggtcctaa ggaacagcga tatctcccac cccatgagct

     1681 gtcacggttt tatttacatg gggtcaggat tccacgaggg tagtgaacca ttttagtcac

     1741 aagggcagtg gctgaagatc aaggagcggg cagtgaactc tcctgaatct tcgcctgctt

     1801 cttcattctc cttcgtttag ctaatagaat aactgctgag ttgtgaacag taaggtgtat

     1861 gtgaggtgct cgaaaacaag gtttcaggtg acgcccccag aataaaattt ggacgggggg

     1921 ttcagtggtg gcattgtgct atgacaccaa tataaccctc acaaacccct tgggcaataa

     1981 atactagtgt aggaatgaaa cattctgaat atctttaaca atagaaatcc atggggtggg

     2041 gacaagccgt aaagactgga tgtccatctc acacgaattt atggctatgg gcaacacata

     2101 atcctagtgc aatatgatac tggggttatt aagatgtgtc ccaggcaggg accaagacag

     2161 gtgaaccatg ttgttacact ctatttgtaa caaggggaaa gagagtggac gccgacagca

     2221 gcggactcca ctggttgtct ctaacacccc cgaaaattaa acggggctcc acgccaatgg

     2281 ggcccataaa caaagacaag tggccactct tttttttgaa attgtggagt gggggcacgc

     2341 gtcagccccc acacgccgcc ctgcggtttt ggactgtaaa ataagggtgt aataacttgg

     2401 ctgattgtaa ccccgctaac cactgcggtc aaaccacttg cccacaaaac cactaatggc

     2461 accccgggga atacctgcat aagtaggtgg gcgggccaag ataggggcgc gattgctgcg

     2521 atctggagga caaattacac acacttgcgc ctgagcgcca agcacagggt tgttggtcct

     2581 catattcacg aggtcgctga gagcacggtg ggctaatgtt gccatgggta gcatatacta

     2641 cccaaatatc tggatagcat atgctatcct aatctatatc tgggtagcat aggctatcct

     2701 aatctatatc tgggtagcat atgctatcct aatctatatc tgggtagtat atgctatcct

     2761 aatttatatc tgggtagcat aggctatcct aatctatatc tgggtagcat atgctatcct

     2821 aatctatatc tgggtagtat atgctatcct aatctgtatc cgggtagcat atgctatcct

     2881 aatagagatt agggtagtat atgctatcct aatttatatc tgggtagcat atactaccca

     2941 aatatctgga tagcatatgc tatcctaatc tatatctggg tagcatatgc tatcctaatc

     3001 tatatctggg tagcataggc tatcctaatc tatatctggg tagcatatgc tatcctaatc

     3061 tatatctggg tagtatatgc tatcctaatt tatatctggg tagcataggc tatcctaatc

     3121 tatatctggg tagcatatgc tatcctaatc tatatctggg tagtatatgc tatcctaatc

     3181 tgtatccggg tagcatatgc tatcctcatg catatacagt cagcatatga tacccagtag

     3241 tagagtggga gtgctatcct ttgcatatgc cgccacctcc caagggggcg tgaattttcg

     3301 ctgcttgtcc ttttcctgct ggttgctccc attcttaggt gaatttaagg aggccaggct

     3361 aaagccgtcg catgtctgat tgctcaccag gtaaatgtcg ctaatgtttt ccaacgcgag

     3421 aaggtgttga gcgcggagct gagtgacgtg acaacatggg tatgcccaat tgccccatgt

     3481 tgggaggacg aaaatggtga caagacagat ggccagaaat acaccaacag cacgcatgat

     3541 gtctactggg gatttattct ttagtgcggg ggaatacacg gcttttaata cgattgaggg

     3601 cgtctcctaa caagttacat cactcctgcc cttcctcacc ctcatctcca tcacctcctt

     3661 catctccgtc atctccgtca tcaccctccg cggcagcccc ttccaccata ggtggaaacc

     3721 agggaggcaa atctactcca tcgtcaaagc tgcacacagt caccctgata ttgcaggtag

     3781 gagcgggctt tgtcataaca aggtccttaa tcgcatcctt caaaacctca gcaaatatat

     3841 gagtttgtaa aaagaccatg aaataacaga caatggactc ccttagcggg ccaggttgtg

     3901 ggccgggtcc aggggccatt ccaaagggga gacgactcaa tggtgtaaga cgacattgtg

     3961 gaatagcaag ggcagttcct cgccttaggt tgtaaaggga ggtcttacta cctccatata

     4021 cgaacacacc ggcgacccaa gttccttcgt cggtagtcct ttctacgtga ctcctagcca

     4081 ggagagctct taaaccttct gcaatgttct caaatttcgg gttggaacct ccttgaccac

     4141 gatgctttcc aaaccaccct ccttttttgc gcctgcctcc atcaccctga ccccggggtc

     4201 cagtgcttgg gccttctcct gggtcatctg cggggccctg ctctatcgct cccgggggca

     4261 cgtcaggctc accatctggg ccaccttctt ggtggtattc aaaataatcg gcttccccta

     4321 cagggtggaa aaatggcctt ctacctggag ggggcctgcg cggtggagac ccggatgatg

     4381 atgactgact actgggactc ctgggcctct tttctccacg tccacgacct ctccccctgg

     4441 ctctttcacg acttcccccc ctggctcttt cacgtcctct accccggcgg cctccactac

     4501 ctcctcgacc ccggcctcca ctacctcctc gaccccggcc tccactgcct cctcgacccc

     4561 ggcctccacc tcctgctcct gcccctcctg ctcctgcccc tcctcctgct cctgcccctc

     4621 ctgcccctcc tgctcctgcc cctcctgccc ctcctgctcc tgcccctcct gcccctcctg

     4681 ctcctgcccc tcctgcccct cctcctgctc ctgcccctcc tgcccctcct cctgctcctg

     4741 cccctcctgc ccctcctgct cctgcccctc ctgcccctcc tgctcctgcc cctcctgccc

     4801 ctcctgctcc tgcccctcct gctcctgccc ctcctgctcc tgcccctcct gctcctgccc

     4861 ctcctgcccc tcctgcccct cctcctgctc ctgcccctcc tgctcctgcc cctcctgccc

     4921 ctcctgcccc tcctgctcct gcccctcctc ctgctcctgc ccctcctgcc cctcctgccc

     4981 ctcctcctgc tcctgcccct cctgcccctc ctcctgctcc tgcccctcct cctgctcctg

     5041 cccctcctgc ccctcctgcc cctcctcctg ctcctgcccc tcctgcccct cctcctgctc

     5101 ctgcccctcc tcctgctcct gcccctcctg cccctcctgc ccctcctcct gctcctgccc

     5161 ctcctcctgc tcctgcccct cctgcccctc ctgcccctcc tgcccctcct cctgctcctg

     5221 cccctcctcc tgctcctgcc cctcctgctc ctgcccctcc cgctcctgct cctgctcctg

     5281 ttccaccgtg ggtccctttg cagccaatgc aacttggacg tttttggggt ctccggacac

     5341 catctctatg tcttggccct gatcctgagc cgcccggggc tcctggtctt ccgcctcctc

     5401 gtcctcgtcc tcttccccgt cctcgtccat ggttatcacc ccctcttctt tgaggtccac

     5461 tgccgccgga gccttctggt ccagatgtgt ctcccttctc tcctaggcca tttccaggtc

     5521 ctgtacctgg cccctcgtca gacatgattc acactaaaag agatcaatag acatctttat

     5581 tagacgacgc tcagtgaata cagggagtgc agactcctgc cccctccaac agccccccca

     5641 ccctcatccc cttcatggtc gctgtcagac agatccaggt ctgaaaattc cccatcctcc

     5701 gaaccatcct cgtcctcatc accaattact cgcagcccgg aaaactcccg ctgaacatcc

     5761 tcaagatttg cgtcctgagc ctcaagccag gcctcaaatt cctcgtcccc ctttttgctg

     5821 gacggtaggg atggggattc tcgggacccc tcctcttcct cttcaaggtc accagacaga

     5881 gatgctactg gggcaacgga agaaaagctg ggtgcggcct gtgaggatca gcttatcgat

     5941 gataagctgt caaacatgag aattcttgaa gacgaaaggg cctcgtgata cgcctatttt

     6001 tataggttaa tgtcatgata ataatggttt cttagacgtc aggtggcact tttcggggaa

     6061 atgtgcgcgg aacccctatt tgtttatttt tctaaataca ttcaaatatg tatccgctca

     6121 tgagacaata accctgataa atgcttcaat aatattgaaa aaggaagagt atgagtattc

     6181 aacatttccg tgtcgccctt attccctttt ttgcggcatt ttgccttcct gtttttgctc

     6241 acccagaaac gctggtgaaa gtaaaagatg ctgaagatca gttgggtgca cgagtgggtt

     6301 acatcgaact ggatctcaac agcggtaaga tccttgagag ttttcgcccc gaagaacgtt

     6361 ttccaatgat gagcactttt aaagttctgc tatgtggcgc ggtattatcc cgtgttgacg

     6421 ccgggcaaga gcaactcggt cgccgcatac actattctca gaatgacttg gttgagtact

     6481 caccagtcac agaaaagcat cttacggatg gcatgacagt aagagaatta tgcagtgctg

     6541 ccataaccat gagtgataac actgcggcca acttacttct gacaacgatc ggaggaccga

     6601 aggagctaac cgcttttttg cacaacatgg gggatcatgt aactcgcctt gatcgttggg

     6661 aaccggagct gaatgaagcc ataccaaacg acgagcgtga caccacgatg cctgcagcaa

     6721 tggcaacaac gttgcgcaaa ctattaactg gcgaactact tactctagct tcccggcaac

     6781 aattaataga ctggatggag gcggataaag ttgcaggacc acttctgcgc tcggcccttc

     6841 cggctggctg gtttattgct gataaatctg gagccggtga gcgtgggtct cgcggtatca

     6901 ttgcagcact ggggccagat ggtaagccct cccgtatcgt agttatctac acgacgggga

     6961 gtcaggcaac tatggatgaa cgaaatagac agatcgctga gataggtgcc tcactgatta

     7021 agcattggta actgtcagac caagtttact catatatact ttagattgat ttaaaacttc

     7081 atttttaatt taaaaggatc taggtgaaga tcctttttga taatctcatg accaaaatcc

     7141 cttaacgtga gttttcgttc cactgagcgt cagaccccgt agaaaagatc aaaggatctt

     7201 cttgagatcc tttttttctg cgcgtaatct gctgcttgca aacaaaaaaa ccaccgctac

     7261 cagcggtggt ttgtttgccg gatcaagagc taccaactct ttttccgaag gtaactggct

     7321 tcagcagagc gcagatacca aatactgtcc ttctagtgta gccgtagtta ggccaccact

     7381 tcaagaactc tgtagcaccg cctacatacc tcgctctgct aatcctgtta ccagtggctg

     7441 ctgccagtgg cgataagtcg tgtcttaccg ggttggactc aagacgatag ttaccggata

     7501 aggcgcagcg gtcgggctga acggggggtt cgtgcacaca gcccagcttg gagcgaacga

     7561 cctacaccga actgagatac ctacagcgtg agctatgaga aagcgccacg cttcccgaag

     7621 ggagaaaggc ggacaggtat ccggtaagcg gcagggtcgg aacaggagag cgcacgaggg

     7681 agcttccagg gggaaacgcc tggtatcttt atagtcctgt cgggtttcgc cacctctgac

     7741 ttgagcgtcg atttttgtga tgctcgtcag gggggcggag cctatggaaa aacgccagca

     7801 acgcggcctt tttacggttc ctggcctttt gctggccttg aagctgtccc tgatggtcgt

     7861 catctacctg cctggacagc atggcctgca acgcgggcat cccgatgccg ccggaagcga

     7921 gaagaatcat aatggggaag gccatccagc ctcgcgtcgc gaacgccagc aagacgtagc

     7981 ccagcgcgtc ggccccgaga tgcgccgcgt gcggctgctg gagatggcgg acgcgatgga

     8041 tatgttctgc caagggttgg tttgcgcatt cacagttctc cgcaagaatt gattggctcc

     8101 aattcttgga gtggtgaatc cgttagcgag gtgccgccct gcttcatccc cgtggcccgt

     8161 tgctcgcgtt tgctggcggt gtccccggaa gaaatatatt tgcatgtctt tagttctatg

     8221 atgacacaaa ccccgcccag cgtcttgtca ttggcgaatt cgaacacgca gatgcagtcg

     8281 gggcggcgcg gtccgaggtc cacttcgcat attaaggtga cgcgtgtggc ctcgaacacc

     8341 gagcgaccct gcagcgaccc gcttaacagc gtcaacagcg tgccgcagat cccggggggc

     8401 aatgagatat gaaaaagcct gaactcaccg cgacgtctgt cgagaagttt ctgatcgaaa

     8461 agttcgacag cgtctccgac ctgatgcagc tctcggaggg cgaagaatct cgtgctttca

     8521 gcttcgatgt aggagggcgt ggatatgtcc tgcgggtaaa tagctgcgcc gatggtttct

     8581 acaaagatcg ttatgtttat cggcactttg catcggccgc gctcccgatt ccggaagtgc

     8641 ttgacattgg ggaattcagc gagagcctga cctattgcat ctcccgccgt gcacagggtg

     8701 tcacgttgca agacctgcct gaaaccgaac tgcccgctgt tctgcagccg gtcgcggagg

     8761 ccatggatgc gatcgctgcg gccgatctta gccagacgag cgggttcggc ccattcggac

     8821 cgcaaggaat cggtcaatac actacatggc gtgatttcat atgcgcgatt gctgatcccc

     8881 atgtgtatca ctggcaaact gtgatggacg acaccgtcag tgcgtccgtc gcgcaggctc

     8941 tcgatgagct gatgctttgg gccgaggact gccccgaagt ccggcacctc gtgcacgcgg

     9001 atttcggctc caacaatgtc ctgacggaca atggccgcat aacagcggtc attgactgga

     9061 gcgaggcgat gttcggggat tcccaatacg aggtcgccaa catcttcttc tggaggccgt

     9121 ggttggcttg tatggagcag cagacgcgct acttcgagcg gaggcatccg gagcttgcag

     9181 gatcgccgcg gctccgggcg tatatgctcc gcattggtct tgaccaactc tatcagagct

     9241 tggttgacgg caatttcgat gatgcagctt gggcgcaggg tcgatgcgac gcaatcgtcc

     9301 gatccggagc cgggactgtc gggcgtacac aaatcgcccg cagaagcgcg gccgtctgga

     9361 ccgatggctg tgtagaagta ctcgccgata gtggaaaccg acgccccagc actcgtccgg

     9421 atcgggagat gggggaggct aactgaaaca cggaaggaga caataccgga aggaacccgc

     9481 gctatgacgg caataaaaag acagaataaa acgcacgggt gttgggtcgt ttgttcataa

     9541 acgcggggtt cggtcccagg gctggcactc tgtcgatacc ccaccgagac cccattgggg

     9601 ccaatacgcc cgcgtttctt ccttttcccc accccacccc ccaagttcgg gtgaaggccc

     9661 agggctcgca gccaacgtcg gggcggcagg ccctgccata gccactggcc ccgtgggtta

     9721 gggacggggt cccccatggg gaatggttta tggttcgtgg gggttattat tttgggcgtt

     9781 gcgtggggtc aggtccacga ctggactgag cagacagacc catggttttt ggatggcctg

     9841 ggcatggacc gcatgtactg gcgcgacacg aacaccgggc gtctgtggct gccaaacacc

     9901 cccgaccccc aaaaaccacc gcgcggattt ctggcgtgcc aagctagtcg accaattctc

     9961 atgtttgaca gcttatcatc gcagatccgg gcaacgttgt tgccattgct gcaggcgcag

    10021 aactggtagg tatggaagat ctatacattg aatcaatatt ggcaattagc catattagtc

    10081 attggttata tagcataaat caatattggc tattggccat tgcatacgtt gtatctatat

    10141 cataatatgt acatttatat tggctcatgt ccaatatgac cgccat



Product is for research use only!


Search name

pCEP4,Plasmid pCEP4,pCEP4 vector

No customer comments for the moment.

Add A Comment

Related Products


No products

Total $0.00

Prices don't include postage.
