pCMV- dR8.91 Plasmid


  • Model: PVT2323
  • 50 Units in Stock
Ask a question

Add to Cart:


PVT2323 2ug


pCMV-dR8.91 Information

Promoter: CMV, SP6
Replicator: pUC, ori, SV40, ori
Plasmid classification: viral series, lentivirus packaging vector
Plasmid size: 12150bp
Prokaryotic resistance: Amp
Clone strain: Stbl3
Culture conditions: 37 DEG C, aerobic LB
Expression host: mammalian cells
Induction mode: no induction, transient expression
Primers for 5'sequencing: SP6:ATTTAGGTGACACTATAGAA
Primers for 3'sequencing: primers were designed according to sequences

pCMV-dR8.91 Sequences

LOCUS       Exported               12150 bp ds-DNA     circular SYN 27-AUG-2016

DEFINITION  synthetic circular DNA



KEYWORDS    Untitled 31

SOURCE      synthetic DNA construct

  ORGANISM  synthetic DNA construct

REFERENCE   1  (bases 1 to 12150)


  TITLE     Direct Submission

  JOURNAL   Exported Saturday, August 27, 2016 from SnapGene Viewer 3.1.4

FEATURES             Location/Qualifiers

     source          1..12150

                     /organism="synthetic DNA construct"

                     /mol_type="other DNA"

     promoter        377..580

                     /note="CMV promoter"

                     /note="human cytomegalovirus (CMV) immediate early 


     CDS             855..2357



                     /product="gag protein from human immunodeficiency virus 1"

                     /note="HIV-1 gag"










     CDS             2150..5161



                     /product="pol protein from human immunodeficiency virus 1"

                     /note="HIV-1 pol"



















     misc_feature    4846..4963


                     /note="central polypurine tract and central termination 

                     sequence of HIV-1"

     misc_feature    5735..5968


                     /note="The Rev response element (RRE) of HIV-1 allows for 

                     Rev-dependent mRNA export from the nucleus to the 


     promoter        complement(7140..7158)

                     /note="SP6 promoter"

                     /note="promoter for bacteriophage SP6 RNA polymerase"

     promoter        7946..8050


                     /note="AmpR promoter"

     CDS             8051..8911





                     /note="confers resistance to ampicillin, carbenicillin, and

                     related antibiotics"







     rep_origin      9082..9670



                     /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of 


     promoter        9916..10245

                     /note="SV40 promoter"

                     /note="SV40 enhancer and early promoter"

     rep_origin      10096..10231

                     /note="SV40 ori"

                     /note="SV40 origin of replication"

     intron          11478..11543

                     /note="small t intron"

                     /note="simian virus 40 (SV40) small t antigen intron"

     CDS             11673..11693


                     /product="nuclear localization signal of SV40 large T 


                     /note="SV40 NLS"


     enhancer        12147..376

                     /note="CMV enhancer"

                     /note="human cytomegalovirus immediate early enhancer"


        1 ttgattattg actagttatt aatagtaatc aattacgggg tcattagttc atagcccata

       61 tatggagttc cgcgttacat aacttacggt aaatggcccg cctggctgac cgcccaacga

      121 cccccgccca ttgacgtcaa taatgacgta tgttcccata gtaacgccaa tagggacttt

      181 ccattgacgt caatgggtgg agtatttacg gtaaactgcc cacttggcag tacatcaagt

      241 gtatcatatg ccaagtacgc cccctattga cgtcaatgac ggtaaatggc ccgcctggca

      301 ttatgcccag tacatgacct tatgggactt tcctacttgg cagtacatct acgtattagt

      361 catcgctatt accatggtga tgcggttttg gcagtacatc aatgggcgtg gatagcggtt

      421 tgactcacgg ggatttccaa gtctccaccc cattgacgtc aatgggagtt tgttttggca

      481 ccaaaatcaa cgggactttc caaaatgtcg taacaactcc gccccattga cgcaaatggg

      541 cggtaggcgt gtacggtggg aggtctatat aagcagagct cgtttagtga accgtcagat

      601 cgcctggaga cgccatccac gctgttttga cctccataga agacaccggg accgatccag

      661 cctccgcggc cgggaacggt gcattggaac gcggattccc cgtgccaaga gtgacgtaag

      721 taccgcctat agagtctata ggcccacccc cttggcttct tatgcgacgg atcgatcccg

      781 taataagctt cgaggtccgc ggccggccgc gttgacgcgc acggcaagag gcgaggggcg

      841 gcgactggtg agagatgggt gcgagagcgt cagtattaag cgggggagaa ttagatcgat

      901 gggaaaaaat tcggttaagg ccagggggaa agaaaaaata taaattaaaa catatagtat

      961 gggcaagcag ggagctagaa cgattcgcag ttaatcctgg cctgttagaa acatcagaag

     1021 gctgtagaca aatactggga cagctacaac catcccttca gacaggatca gaagaactta

     1081 gatcattata taatacagta gcaaccctct attgtgtgca tcaaaggata gagataaaag

     1141 acaccaagga agctttagac aagatagagg aagagcaaaa caaaagtaag aaaaaagcac

     1201 agcaagcagc agctgacaca ggacacagca atcaggtcag ccaaaattac cctatagtgc

     1261 agaacatcca ggggcaaatg gtacatcagg ccatatcacc tagaacttta aatgcatggg

     1321 taaaagtagt agaagagaag gctttcagcc cagaagtgat acccatgttt tcagcattat

     1381 cagaaggagc caccccacaa gatttaaaca ccatgctaaa cacagtgggg ggacatcaag

     1441 cagccatgca aatgttaaaa gagaccatca atgaggaagc tgcagaatgg gatagagtgc

     1501 atccagtgca tgcagggcct attgcaccag gccagatgag agaaccaagg ggaagtgaca

     1561 tagcaggaac tactagtacc cttcaggaac aaataggatg gatgacacat aatccaccta

     1621 tcccagtagg agaaatctat aaaagatgga taatcctggg attaaataaa atagtaagaa

     1681 tgtatagccc taccagcatt ctggacataa gacaaggacc aaaggaaccc tttagagact

     1741 atgtagaccg attctataaa actctaagag ccgagcaagc ttcacaagag gtaaaaaatt

     1801 ggatgacaga aaccttgttg gtccaaaatg cgaacccaga ttgtaagact attttaaaag

     1861 cattgggacc aggagcgaca ctagaagaaa tgatgacagc atgtcaggga gtggggggac

     1921 ccggccataa agcaagagtt ttggctgaag caatgagcca agtaacaaat ccagctacca

     1981 taatgataca gaaaggcaat tttaggaacc aaagaaagac tgttaagtgt ttcaattgtg

     2041 gcaaagaagg gcacatagcc aaaaattgca gggcccctag gaaaaagggc tgttggaaat

     2101 gtggaaagga aggacaccaa atgaaagatt gtactgagag acaggctaat tttttaggga

     2161 agatctggcc ttcccacaag ggaaggccag ggaattttct tcagagcaga ccagagccaa

     2221 cagccccacc agaagagagc ttcaggtttg gggaagagac aacaactccc tctcagaagc

     2281 aggagccgat agacaaggaa ctgtatcctt tagcttccct cagatcactc tttggcagcg

     2341 acccctcgtc acaataaaga taggggggca attaaaggaa gctctattag atacaggagc

     2401 agatgataca gtattagaag aaatgaattt gccaggaaga tggaaaccaa aaatgatagg

     2461 gggaattgga ggttttatca aagtaagaca gtatgatcag atactcatag aaatctgcgg

     2521 acataaagct ataggtacag tattagtagg acctacacct gtcaacataa ttggaagaaa

     2581 tctgttgact cagattggct gcactttaaa ttttcccatt agtcctattg agactgtacc

     2641 agtaaaatta aagccaggaa tggatggccc aaaagttaaa caatggccat tgacagaaga

     2701 aaaaataaaa gcattagtag aaatttgtac agaaatggaa aaggaaggaa aaatttcaaa

     2761 aattgggcct gaaaatccat acaatactcc agtatttgcc ataaagaaaa aagacagtac

     2821 taaatggaga aaattagtag atttcagaga acttaataag agaactcaag atttctggga

     2881 agttcaatta ggaataccac atcctgcagg gttaaaacag aaaaaatcag taacagtact

     2941 ggatgtgggc gatgcatatt tttcagttcc cttagataaa gacttcagga agtatactgc

     3001 atttaccata cctagtataa acaatgagac accagggatt agatatcagt acaatgtgct

     3061 tccacaggga tggaaaggat caccagcaat attccagtgt agcatgacaa aaatcttaga

     3121 gccttttaga aaacaaaatc cagacatagt catctatcaa tacatggatg atttgtatgt

     3181 aggatctgac ttagaaatag ggcagcatag aacaaaaata gaggaactga gacaacatct

     3241 gttgaggtgg ggatttacca caccagacaa aaaacatcag aaagaacctc cattcctttg

     3301 gatgggttat gaactccatc ctgataaatg gacagtacag cctatagtgc tgccagaaaa

     3361 ggacagctgg actgtcaatg acatacagaa attagtggga aaattgaatt gggcaagtca

     3421 gatttatgca gggattaaag taaggcaatt atgtaaactt cttaggggaa ccaaagcact

     3481 aacagaagta gtaccactaa cagaagaagc agagctagaa ctggcagaaa acagggagat

     3541 tctaaaagaa ccggtacatg gagtgtatta tgacccatca aaagacttaa tagcagaaat

     3601 acagaagcag gggcaaggcc aatggacata tcaaatttat caagagccat ttaaaaatct

     3661 gaaaacagga aagtatgcaa gaatgaaggg tgcccacact aatgatgtga aacaattaac

     3721 agaggcagta caaaaaatag ccacagaaag catagtaata tggggaaaga ctcctaaatt

     3781 taaattaccc atacaaaagg aaacatggga agcatggtgg acagagtatt ggcaagccac

     3841 ctggattcct gagtgggagt ttgtcaatac ccctccctta gtgaagttat ggtaccagtt

     3901 agagaaagaa cccataatag gagcagaaac tttctatgta gatggggcag ccaataggga

     3961 aactaaatta ggaaaagcag gatatgtaac tgacagagga agacaaaaag ttgtccccct

     4021 aacggacaca acaaatcaga agactgagtt acaagcaatt catctagctt tgcaggattc

     4081 gggattagaa gtaaacatag tgacagactc acaatatgca ttgggaatca ttcaagcaca

     4141 accagataag agtgaatcag agttagtcag tcaaataata gagcagttaa taaaaaagga

     4201 aaaagtctac ctggcatggg taccagcaca caaaggaatt ggaggaaatg aacaagtaga

     4261 taaattggtc agtgctggaa tcaggaaagt actattttta gatggaatag ataaggccca

     4321 agaagaacat gagaaatatc acagtaattg gagagcaatg gctagtgatt ttaacctacc

     4381 acctgtagta gcaaaagaaa tagtagccag ctgtgataaa tgtcagctaa aaggggaagc

     4441 catgcatgga caagtagact gtagcccagg aatatggcag ctagattgta cacatttaga

     4501 aggaaaagtt atcttggtag cagttcatgt agccagtgga tatatagaag cagaagtaat

     4561 tccagcagag acagggcaag aaacagcata cttcctctta aaattagcag gaagatggcc

     4621 agtaaaaaca gtacatacag acaatggcag caatttcacc agtactacag ttaaggccgc

     4681 ctgttggtgg gcggggatca agcaggaatt tggcattccc tacaatcccc aaagtcaagg

     4741 agtaatagaa tctatgaata aagaattaaa gaaaattata ggacaggtaa gagatcaggc

     4801 tgaacatctt aagacagcag tacaaatggc agtattcatc cacaatttta aaagaaaagg

     4861 ggggattggg gggtacagtg caggggaaag aatagtagac ataatagcaa cagacataca

     4921 aactaaagaa ttacaaaaac aaattacaaa aattcaaaat tttcgggttt attacaggga

     4981 cagcagagat ccagtttgga aaggaccagc aaagctcctc tggaaaggtg aaggggcagt

     5041 agtaatacaa gataatagtg acataaaagt agtgccaaga agaaaagcaa agatcatcag

     5101 ggattatgga aaacagatgg caggtgatga ttgtgtggca agtagacagg atgaggatta

     5161 acacatggaa ttctgcaaca actgctgttt atccatttca gaattgggtg tcgacatagc

     5221 agaataggcg ttactcgaca gaggagagca agaaatggag ccagtagatc ctagactaga

     5281 gccctggaag catccaggaa gtcagcctaa aactgcttgt accaattgct attgtaaaaa

     5341 gtgttgcttt cattgccaag tttgtttcat gacaaaagcc ttaggcatct cctatggcag

     5401 gaagaagcgg agacagcgac gaagagctca tcagaacagt cagactcatc aagcttctct

     5461 atcaaagcag taagtagtac atgtaatgca acctataata gtagcaatag tagcattagt

     5521 agtagcaata ataatagcaa tagttgtgtg gtccatagta atcatagaat ataggaaaat

     5581 ggccgctgat cttcagacct ggaggaggag atatgaggga caattggaga agtgaattat

     5641 ataaatataa agtagtaaaa attgaaccat taggagtagc acccaccaag gcaaagagaa

     5701 gagtggtgca gagagaaaaa agagcagtgg gaataggagc tttgttcctt gggttcttgg

     5761 gagcagcagg aagcactatg ggcgcagcgt caatgacgct gacggtacag gccagacaat

     5821 tattgtctgg tatagtgcag cagcagaaca atttgctgag ggctattgag gcgcaacagc

     5881 atctgttgca actcacagtc tggggcatca agcagctcca ggcaagaatc ctggctgtgg

     5941 aaagatacct aaaggatcaa cagctcctgg ggatttgggg ttgctctgga aaactcattt

     6001 gcaccactgc tgtgccttgg aatgctagtt ggagtaataa atctctggaa cagatttgga

     6061 atcacacgac ctggatggag tgggacagag aaattaacaa ttacacaagc ttaatacact

     6121 ccttaattga agaatcgcaa aaccagcaag aaaagaatga acaagaatta ttggaattag

     6181 ataaatgggc aagtttgtgg aattggttta acataacaaa ttggctgtgg tatataaaat

     6241 tattcataat gatagtagga ggcttggtag gtttaagaat agtttttgct gtactttcta

     6301 tagtgaatag agttaggcag ggatattcac cattatcgtt tcagacccac ctcccaaccc

     6361 cgaggggacc cgacaggccc gaaggaatag aagaagaagg tggagagaga gacagagaca

     6421 gatccattcg attagtgaac ggatccttgg cacttatctg ggacgatctg cggagcctgt

     6481 gcctcttcag ctaccaccgc ttgagagact tactcttgat tgtaacgagg attgtggaac

     6541 ttctgggacg cagggggtgg gaagccctca aatattggtg gaatctccta caatattgga

     6601 gtcaggagct aaagaatagt gctgttagct tgctcaatgc cacagccata gcagtagctg

     6661 aggggacaga tagggttata gaagtagtac aaggagcttg tagagctatt cgccacatac

     6721 ctagaagaat aagacagggc ttggaaagga ttttgctata agctcgaggc cgccccggtg

     6781 accttcagac cttggcactg gaggtggccc ggcagaagcg cggcatcgtg gatcagtgct

     6841 gcaccagcat ctgctctctc taccaactgg agaactactg caactaggcc caccactacc

     6901 ctgtccaccc ctctgcaatg aataaaacct ttgaaagagc actacaagtt gtgtgtacat

     6961 gcgtgcatgt gcatatgtgg tgcgggggga acatgagtgg ggctggctgg agtggcgatg

     7021 ataagctgtc aaacatgaga attaattctt gaagacgaaa gggcctcgtg atacgcctat

     7081 ttttataggt taatgtcatg ataataatgg tttcttagtc tagaattaat tccgtgtatt

     7141 ctatagtgtc acctaaatcg tatgtgtatg atacataagg ttatgtatta attgtagccg

     7201 cgttctaacg acaatatgta caagcctaat tgtgtagcat ctggcttact gaagcagacc

     7261 ctatcatctc tctcgtaaac tgccgtcaga gtcggtttgg ttggacgaac cttctgagtt

     7321 tctggtaacg ccgtcccgca cccggaaatg gtcagcgaac caatcagcag ggtcatcgct

     7381 agccagatcc tctacgccgg acgcatcgtg gccggcatca ccggcgccac aggtgcggtt

     7441 gctggcgcct atatcgccga catcaccgat ggggaagatc gggctcgcca cttcgggctc

     7501 atgagcgctt gtttcggcgt gggtatggtg gcaggccccg tggccggggg actgttgggc

     7561 gccatctcct tgcatgcacc attccttgcg gcggcggtgc tcaacggcct caacctacta

     7621 ctgggctgct tcctaatgca ggagtcgcat aagggagagc gtcgaatggt gcactctcag

     7681 tacaatctgc tctgatgccg catagttaag ccagccccga cacccgccaa cacccgctga

     7741 cgcgccctga cgggcttgtc tgctcccggc atccgcttac agacaagctg tgaccgtctc

     7801 cgggagctgc atgtgtcaga ggttttcacc gtcatcaccg aaacgcgcga gacgaaaggg

     7861 cctcgtgata cgcctatttt tataggttaa tgtcatgata ataatggttt cttagacgtc

     7921 aggtggcact tttcggggaa atgtgcgcgg aacccctatt tgtttatttt tctaaataca

     7981 ttcaaatatg tatccgctca tgagacaata accctgataa atgcttcaat aatattgaaa

     8041 aaggaagagt atgagtattc aacatttccg tgtcgccctt attccctttt ttgcggcatt

     8101 ttgccttcct gtttttgctc acccagaaac gctggtgaaa gtaaaagatg ctgaagatca

     8161 gttgggtgca cgagtgggtt acatcgaact ggatctcaac agcggtaaga tccttgagag

     8221 ttttcgcccc gaagaacgtt ttccaatgat gagcactttt aaagttctgc tatgtggcgc

     8281 ggtattatcc cgtattgacg ccgggcaaga gcaactcggt cgccgcatac actattctca

     8341 gaatgacttg gttgagtact caccagtcac agaaaagcat cttacggatg gcatgacagt

     8401 aagagaatta tgcagtgctg ccataaccat gagtgataac actgcggcca acttacttct

     8461 gacaacgatc ggaggaccga aggagctaac cgcttttttg cacaacatgg gggatcatgt

     8521 aactcgcctt gatcgttggg aaccggagct gaatgaagcc ataccaaacg acgagcgtga

     8581 caccacgatg cctgtagcaa tggcaacaac gttgcgcaaa ctattaactg gcgaactact

     8641 tactctagct tcccggcaac aattaataga ctggatggag gcggataaag ttgcaggacc

     8701 acttctgcgc tcggcccttc cggctggctg gtttattgct gataaatctg gagccggtga

     8761 gcgtgggtct cgcggtatca ttgcagcact ggggccagat ggtaagccct cccgtatcgt

     8821 agttatctac acgacgggga gtcaggcaac tatggatgaa cgaaatagac agatcgctga

     8881 gataggtgcc tcactgatta agcattggta actgtcagac caagtttact catatatact

     8941 ttagattgat ttaaaacttc atttttaatt taaaaggatc taggtgaaga tcctttttga

     9001 taatctcatg accaaaatcc cttaacgtga gttttcgttc cactgagcgt cagaccccgt

     9061 agaaaagatc aaaggatctt cttgagatcc tttttttctg cgcgtaatct gctgcttgca

     9121 aacaaaaaaa ccaccgctac cagcggtggt ttgtttgccg gatcaagagc taccaactct

     9181 ttttccgaag gtaactggct tcagcagagc gcagatacca aatactgttc ttctagtgta

     9241 gccgtagtta ggccaccact tcaagaactc tgtagcaccg cctacatacc tcgctctgct

     9301 aatcctgtta ccagtggctg ctgccagtgg cgataagtcg tgtcttaccg ggttggactc

     9361 aagacgatag ttaccggata aggcgcagcg gtcgggctga acggggggtt cgtgcacaca

     9421 gcccagcttg gagcgaacga cctacaccga actgagatac ctacagcgtg agctatgaga

     9481 aagcgccacg cttcccgaag ggagaaaggc ggacaggtat ccggtaagcg gcagggtcgg

     9541 aacaggagag cgcacgaggg agcttccagg gggaaacgcc tggtatcttt atagtcctgt

     9601 cgggtttcgc cacctctgac ttgagcgtcg atttttgtga tgctcgtcag gggggcggag

     9661 cctatggaaa aacgccagca acgcggcctt tttacggttc ctggcctttt gctggccttt

     9721 tgctcacatg ttctttcctg cgttatcccc tgattctgtg gataaccgta ttaccgcctt

     9781 tgagtgagct gataccgctc gccgcagccg aacgaccgag cgcagcgagt cagtgagcga

     9841 ggaagcggaa gagcgcccaa tacgcaaacc gcctctcccc gcgcgttggc cgattcatta

     9901 atgcagctgt ggaatgtgtg tcagttaggg tgtggaaagt ccccaggctc cccagcaggc

     9961 agaagtatgc aaagcatgca tctcaattag tcagcaacca ggtgtggaaa gtccccaggc

    10021 tccccagcag gcagaagtat gcaaagcatg catctcaatt agtcagcaac catagtcccg

    10081 cccctaactc cgcccatccc gcccctaact ccgcccagtt ccgcccattc tccgccccat

    10141 ggctgactaa ttttttttat ttatgcagag gccgaggccg cctcggcctc tgagctattc

    10201 cagaagtagt gaggaggctt ttttggaggc ctaggctttt gcaaaaagct tggacacaag

    10261 acaggcttgc gagatatgtt tgagaatacc actttatccc gcgtcaggga gaggcagtgc

    10321 gtaaaaagac gcggactcat gtgaaatact ggtttttagt gcgccagatc tctataatct

    10381 cgcgcaacct attttcccct cgaacacttt ttaagccgta gataaacagg ctgggacact

    10441 tcacatgagc gaaaaataca tcgtcacctg ggacatgttg cagatccatg cacgtaaact

    10501 cgcaagccga ctgatgcctt ctgaacaatg gaaaggcatt attgccgtaa gccgtggcgg

    10561 tctgtaccgg gtgcgttact ggcgcgtgaa ctgggtattc gtcatgtcga taccgtttgt

    10621 atttccagct acgatcacga caaccagcgc gagcttaaag tgctgaaacg cgcagaaggc

    10681 gatggcgaag gcttcatcgt tattgatgac ctggtggata ccggtggtac tgcggttgcg

    10741 attcgtgaaa tgtatccaaa agcgcacttt gtcaccatct tcgcaaaacc ggctggtcgt

    10801 ccgctggttg atgactatgt tgttgatatc ccgcaagata cctggattga acagccgtgg

    10861 gatatgggcg tcgtattcgt cccgccaatc tccggtcgct aatcttttca acgcctggca

    10921 ctgccgggcg ttgttctttt taacttcagg cgggttacaa tagtttccag taagtattct

    10981 ggaggctgca tccatgacac aggcaaacct gagcgaaacc ctgttcaaac cccgctttaa

    11041 acatcctgaa acctcgacgc tagtccgccg ctttaatcac ggcgcacaac cgcctgtgca

    11101 gtcggccctt gatggtaaaa ccatccctca ctggtatcgc atgattaacc gtctgatgtg

    11161 gatctggcgc ggcattgacc cacgcgaaat cctcgacgtc caggcacgta ttgtgatgag

    11221 cgatgccgaa cgtaccgacg atgatttata cgatacggtg attggctacc gtggcggcaa

    11281 ctggatttat gagtgggccc cggatctttg tgaaggaacc ttacttctgt ggtgtgacat

    11341 aattggacaa actacctaca gagatttaaa gctctaaggt aaatataaaa tttttaaccc

    11401 ggatctttgt gaaggaacct tacttctgtg gtgtgacata attggacaaa ctacctacag

    11461 agatttaaag ctctaaggta aatataaaat ttttaagtgt ataatgtgtt aaactactga

    11521 ttctaattgt ttgtgtattt tagattccaa cctatggaac tgatgaatgg gagcagtggt

    11581 ggaatgcctt taatgaggaa aacctgtttt gctcagaaga aatgccatct agtgatgatg

    11641 aggctactgc tgactctcaa cattctactc ctccaaaaaa gaagagaaag gtagaagacc

    11701 ccaaggactt tccttcagaa ttgctaagtt ttttgagtca tgctgtgttt agtaatagaa

    11761 ctcttgcttg ctttgctatt tacaccacaa aggaaaaagc tgcactgcta tacaagaaaa

    11821 ttatggaaaa atattctgta acctttataa gtaggcataa cagttataat cataacatac

    11881 tgttttttct tactccacac aggcatagag tgtctgctat taataactat gctcaaaaat

    11941 tgtgtacctt tagcttttta atttgtaaag gggttaataa ggaatatttg atgtatagtg

    12001 ccttgactag agatcataat cagccatacc acatttgtag aggttttact tgctttaaaa

    12061 aacctcccac acctccccct gaacctgaaa cataaaatga atgcaattgt tgttgttggg

    12121 ctgcaggaat taattcgagc tcgcccgaca


Product is for research use only!


Search name

pCMV-dR8.91,Plasmid pCMV-dR8.91,pCMV-dR8.91 vector

No customer comments for the moment.

Add A Comment

Related Products


No products

Total $0.00

Prices don't include postage.
