pCMV- dR8.91 Plasmid


  • Model: PVT2323
  • 50 Units in Stock
Ask a question

Add to Cart:


Search name

pCMV-dR8.91,Plasmid pCMV-dR8.91,pCMV-dR8.91 vector

Bacterial Resistance:
Growth Strain:



Promoter: CMV, SP6
Replicator: pUC, ori, SV40, ori
Plasmid classification: viral series, lentivirus packaging vector
Plasmid size: 12150bp
Prokaryotic resistance: Amp
Clone strain: Stbl3
Culture conditions: 37 DEG C, aerobic LB
Expression host: mammalian cells
Induction mode: no induction, transient expression
Primers for 5'sequencing: SP6:ATTTAGGTGACACTATAGAA
Primers for 3'sequencing: primers were designed according to sequences


LOCUS       Exported               12150 bp ds-DNA     circular SYN 27-AUG-2016
DEFINITION  synthetic circular DNA
KEYWORDS    Untitled 31
SOURCE      synthetic DNA construct
  ORGANISM  synthetic DNA construct
REFERENCE   1  (bases 1 to 12150)
  TITLE     Direct Submission
  JOURNAL   Exported Saturday, August 27, 2016 from SnapGene Viewer 3.1.4
FEATURES             Location/Qualifiers
     source          1..12150
                     /organism="synthetic DNA construct"
                     /mol_type="other DNA"
     promoter        377..580
                     /note="CMV promoter"
                     /note="human cytomegalovirus (CMV) immediate early 
     CDS             855..2357
                     /product="gag protein from human immunodeficiency virus 1"
                     /note="HIV-1 gag"
     CDS             2150..5161
                     /product="pol protein from human immunodeficiency virus 1"
                     /note="HIV-1 pol"
     misc_feature    4846..4963
                     /note="central polypurine tract and central termination 
                     sequence of HIV-1"
     misc_feature    5735..5968
                     /note="The Rev response element (RRE) of HIV-1 allows for 
                     Rev-dependent mRNA export from the nucleus to the 
     promoter        complement(7140..7158)
                     /note="SP6 promoter"
                     /note="promoter for bacteriophage SP6 RNA polymerase"
     promoter        7946..8050
                     /note="AmpR promoter"
     CDS             8051..8911
                     /note="confers resistance to ampicillin, carbenicillin, and
                     related antibiotics"
     rep_origin      9082..9670
                     /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of 
     promoter        9916..10245
                     /note="SV40 promoter"
                     /note="SV40 enhancer and early promoter"
     rep_origin      10096..10231
                     /note="SV40 ori"
                     /note="SV40 origin of replication"
     intron          11478..11543
                     /note="small t intron"
                     /note="simian virus 40 (SV40) small t antigen intron"
     CDS             11673..11693
                     /product="nuclear localization signal of SV40 large T 
                     /note="SV40 NLS"
     enhancer        12147..376
                     /note="CMV enhancer"
                     /note="human cytomegalovirus immediate early enhancer"
        1 ttgattattg actagttatt aatagtaatc aattacgggg tcattagttc atagcccata
       61 tatggagttc cgcgttacat aacttacggt aaatggcccg cctggctgac cgcccaacga
      121 cccccgccca ttgacgtcaa taatgacgta tgttcccata gtaacgccaa tagggacttt
      181 ccattgacgt caatgggtgg agtatttacg gtaaactgcc cacttggcag tacatcaagt
      241 gtatcatatg ccaagtacgc cccctattga cgtcaatgac ggtaaatggc ccgcctggca
      301 ttatgcccag tacatgacct tatgggactt tcctacttgg cagtacatct acgtattagt
      361 catcgctatt accatggtga tgcggttttg gcagtacatc aatgggcgtg gatagcggtt
      421 tgactcacgg ggatttccaa gtctccaccc cattgacgtc aatgggagtt tgttttggca
      481 ccaaaatcaa cgggactttc caaaatgtcg taacaactcc gccccattga cgcaaatggg
No customer comments for the moment.

Add A Comment

Related Products


No products

Total $0.00

Prices don't include postage.
