pCMV- Gag- pol

$215.00

  • Model: PVT11061
  • 50 Units in Stock
Ask a question


Add to Cart:

pCMV-Gag-pol


Catalog No. PVT11061
Packing 2ug
Function /
Resistance Amp
Screen /
Strain Stbl3
Culture temperature 37degrees centigrade
Replicon
Copy
Promoter CMV
Induction --
Forward primer CMV-F
Reverse primer hGH-PA-R:CCAGCTTGGTTCCCAATAGA

No customer comments for the moment.

Add A Comment

Related Products

Cart  

No products

Total $0.00

Prices don't include postage.

Cart