pCMV- Gag- pol Plasmid

$193.00

  • Model: PVT2202
  • 48 Units in Stock
Ask a question


Add to Cart:

pCMV-Gag-pol

PVT2202 2ug

Search name

pCMV-Gag-pol ,Plasmid pCMV-Gag-pol ,pCMV-Gag-pol vector

 

pCMV-Gag-pol Information

Promoter: CMV
Terminating child: HGH poly (A) signal
Plasmid Classification: Viral series, retrovirus packaging carrier
Plasmid Size: 11kb
plasmid Label: Gag-pol
Primary nuclear Resistance: AMP
Clone strain: STBL3

Culture conditions: 37 C, aerobic LB

Expression host: mammalian cells

Induction mode: no induction, transient expression

5'Sequencing Primers: CMV-F: CGCAAATGGGGGGGTAGGGGGGTG

3'Sequencing primers: hGH-PA-R: CCAGCTTGGTTCCCAATAGA

No customer comments for the moment.

Add A Comment

Related Products

Cart  

No products

Total $0.00

Prices don't include postage.

Cart