pCMV- Tag 2B


  • Model: PVT1027
  • 50 Units in Stock
Ask a question

Add to Cart:

pCMV-Tag 2B

PVT1027  2ug

pCMV-Tag 2B Information

Promoter: CMV

Replicator: pUC ori, F1 ori

Terminator: SV40 poly (A) signal, HSV-TK poly (A)

Plasmid classification: mammalian cell carrier; protein overexpression plasmid.

Plasmid size: 4324bp

Plasmid label: N-Flag

Prokaryotic resistance: kanamycin Kan

Screening markers: neomycin Neo

Cloned strain: XL1-Blue

Culture conditions: 37 centigrade, aerobic, LB

Expression host: mammalian cells

Culture conditions: 37 centigrade, aerobic, LB

5'sequencing primers: T3: AATTAACCCTCACTAAAGGG

3'sequencing primers: T7: GTAATACGACTCACTATAGGGC


pCMV-Tag 2B Description



pCMV-Tag 2B Sequence

LOCUS       Exported                4324 bp ds-DNA    circular SYN 05-11-2015
KEYWORDS    Untitled 5
SOURCE      synthetic DNA construct
  ORGANISM  synthetic DNA construct
REFERENCE   1  (bases 1 to 4324)
  AUTHORS   admin
  TITLE     Direct Submission
  JOURNAL   Exported 2015-11-5 
FEATURES             Location/Qualifiers
     source          1..4324
                     /organism="synthetic DNA construct"
                     /mol_type="other DNA"
     enhancer        67..370
                     /note="CMV enhancer"
                     /note="human cytomegalovirus immediate early enhancer"
     promoter        371..574
                     /note="CMV promoter"
                     /note="human cytomegalovirus (CMV) immediate early
     promoter        620..638
                     /note="T3 promoter"
                     /note="promoter for bacteriophage T3 RNA polymerase"
     CDS             682..705
                     /product="FLAG(R) epitope tag, followed by an enterokinase
                     cleavage site"
     primer_bind     complement(753..769)
                     /note="KS primer"
                     /note="common sequencing primer, one of multiple similar
     promoter        complement(826..844)
                     /note="T7 promoter"
                     /note="promoter for bacteriophage T7 RNA polymerase"
     polyA_signal    1118..1239
                     /note="SV40 poly(A) signal"
                     /note="SV40 polyadenylation signal"
     rep_origin      complement(1246..1701)
                     /note="f1 ori"
                     /note="f1 bacteriophage origin of replication; arrow
                     indicates direction of (+) strand synthesis"
     promoter        1728..1832
                     /note="AmpR promoter"
     promoter        1834..2191
                     /note="SV40 promoter"
                     /note="SV40 enhancer and early promoter"
     rep_origin      2042..2177
                     /note="SV40 ori"
                     /note="SV40 origin of replication"
     CDS             2226..3020
                     /gene="aph(3')-II (or nptII)"
                     /product="aminoglycoside phosphotransferase from Tn5"
                     /note="confers resistance to neomycin, kanamycin, and G418
     polyA_signal    3252..3299
                     /note="HSV TK poly(A) signal"
                     /note="herpesvirus thymidine kinase polyadenylation signal"
     rep_origin      3628..4216
                     /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of
        1 atgcattagt tattaatagt aatcaattac ggggtcatta gttcatagcc catatatgga
       61 gttccgcgtt acataactta cggtaaatgg cccgcctggc tgaccgccca acgacccccg
      121 cccattgacg tcaataatga cgtatgttcc catagtaacg ccaataggga ctttccattg
      181 acgtcaatgg gtggagtatt tacggtaaac tgcccacttg gcagtacatc aagtgtatca
      241 tatgccaagt acgcccccta ttgacgtcaa tgacggtaaa tggcccgcct ggcattatgc
      301 ccagtacatg accttatggg actttcctac ttggcagtac atctacgtat tagtcatcgc
      361 tattaccatg gtgatgcggt tttggcagta catcaatggg cgtggatagc ggtttgactc
      421 acggggattt ccaagtctcc accccattga cgtcaatggg agtttgtttt ggcaccaaaa
      481 tcaacgggac tttccaaaat gtcgtaacaa ctccgcccca ttgacgcaaa tgggcggtag
      541 gcgtgtacgg tgggaggtct atataagcag agctggttta gtgaaccgtc agatccgcta
      601 gcgattacgc caagctcgaa attaaccctc actaaaggga acaaaagctg gagctccacc
      661 gcggtggcgg ccgccaccat ggattacaag gatgacgacg ataagagccc gggcggatcc
      721 cccgggctgc aggaattcga tatcaagctt atcgataccg tcgacctcga gggggggccc
      781 ggtaccttaa ttaattaagg taccaggtaa gtgtacccaa ttcgccctat agtgagtcgt
      841 attacaattc actcgatcgc ccttcccaac agttgcgcag cctgaatggc gaatggagat
      901 ccaattttta agtgtataat gtgttaaact actgattcta attgtttgtg tattttagat
      961 tcacagtccc aaggctcatt tcaggcccct cagtcctcac agtctgttca tgatcataat
     1021 cagccatacc acatttgtag aggttttact tgctttaaaa aacctcccac acctccccct
     1081 gaacctgaaa cataaaatga atgcaattgt tgttgttaac ttgtttattg cagcttataa
     1141 tggttacaaa taaagcaata gcatcacaaa tttcacaaat aaagcatttt tttcactgca
     1201 ttctagttgt ggtttgtcca aactcatcaa tgtatcttaa cgcgtaaatt gtaagcgtta
     1261 atattttgtt aaaattcgcg ttaaattttt gttaaatcag ctcatttttt aaccaatagg
     1321 ccgaaatcgg caaaatccct tataaatcaa aagaatagac cgagataggg ttgagtgttg
     1381 ttccagtttg gaacaagagt ccactattaa agaacgtgga ctccaacgtc aaagggcgaa
     1441 aaaccgtcta tcagggcgat ggcccactac gtgaaccatc accctaatca agttttttgg
     1501 ggtcgaggtg ccgtaaagca ctaaatcgga accctaaagg gagcccccga tttagagctt
     1561 gacggggaaa gccggcgaac gtggcgagaa aggaagggaa gaaagcgaaa ggagcgggcg
     1621 ctagggcgct ggcaagtgta gcggtcacgc tgcgcgtaac caccacaccc gccgcgctta
     1681 atgcgccgct acagggcgcg tcaggtggca cttttcgggg aaatgtgcgc ggaaccccta
     1741 tttgtttatt tttctaaata cattcaaata tgtatccgct catgagacaa taaccctgat
     1801 aaatgcttca ataatattga aaaaggaaga atcctgaggc ggaaagaacc agctgtggaa
     1861 tgtgtgtcag ttagggtgtg gaaagtcccc aggctcccca gcaggcagaa gtatgcaaag
     1921 catgcatctc aattagtcag caaccaggtg tggaaagtcc ccaggctccc cagcaggcag
     1981 aagtatgcaa agcatgcatc tcaattagtc agcaaccata gtcccgcccc taactccgcc
     2041 catcccgccc ctaactccgc ccagttccgc ccattctccg ccccatggct gactaatttt
     2101 ttttatttat gcagaggccg aggccgcctc ggcctctgag ctattccaga agtagtgagg
     2161 aggctttttt ggaggcctag gcttttgcaa agatcgatca agagacagga tgaggatcgt
     2221 ttcgcatgat tgaacaagat ggattgcacg caggttctcc ggccgcttgg gtggagaggc
     2281 tattcggcta tgactgggca caacagacaa tcggctgctc tgatgccgcc gtgttccggc
     2341 tgtcagcgca ggggcgcccg gttctttttg tcaagaccga cctgtccggt gccctgaatg
     2401 aactgcaaga cgaggcagcg cggctatcgt ggctggccac gacgggcgtt ccttgcgcag
     2461 ctgtgctcga cgttgtcact gaagcgggaa gggactggct gctattgggc gaagtgccgg
     2521 ggcaggatct cctgtcatct caccttgctc ctgccgagaa agtatccatc atggctgatg
     2581 caatgcggcg gctgcatacg cttgatccgg ctacctgccc attcgaccac caagcgaaac
     2641 atcgcatcga gcgagcacgt actcggatgg aagccggtct tgtcgatcag gatgatctgg
     2701 acgaagaaca tcaggggctc gcgccagccg aactgttcgc caggctcaag gcgagcatgc
     2761 ccgacggcga ggatctcgtc gtgacccatg gcgatgcctg cttgccgaat atcatggtgg
     2821 aaaatggccg cttttctgga ttcatcgact gtggccggct gggtgtggcg gaccgctatc
     2881 aggacatagc gttggctacc cgtgatattg ctgaagaact tggcggcgaa tgggctgacc
     2941 gcttcctcgt gctttacggt atcgccgctc ccgattcgca gcgcatcgcc ttctatcgcc
     3001 ttcttgacga gttcttctga gcgggactct ggggttcgaa atgaccgacc aagcgacgcc
     3061 caacctgcca tcacgagatt tcgattccac cgccgccttc tatgaaaggt tgggcttcgg
     3121 aatcgttttc cgggacgccg gctggatgat cctccagcgc ggggatctca tgctggagtt
     3181 cttcgcccac cctaggggga ggctaactga aacacggaag gagacaatac cggaaggaac
     3241 ccgcgctatg acggcaataa aaagacagaa taaaacgcac ggtgttgggt cgtttgttca
     3301 taaacgcggg gttcggtccc agggctggca ctctgtcgat accccaccga gaccccattg
     3361 gggccaatac gcccgcgttt cttccttttc cccaccccac cccccaagtt cgggtgaagg
     3421 cccagggctc gcagccaacg tcggggcggc aggccctgcc atagcctcag gttactcata
     3481 tatactttag attgatttaa aacttcattt ttaatttaaa aggatctagg tgaagatcct
     3541 ttttgataat ctcatgacca aaatccctta acgtgagttt tcgttccact gagcgtcaga
     3601 ccccgtagaa aagatcaaag gatcttcttg agatcctttt tttctgcgcg taatctgctg
     3661 cttgcaaaca aaaaaaccac cgctaccagc ggtggtttgt ttgccggatc aagagctacc
     3721 aactcttttt ccgaaggtaa ctggcttcag cagagcgcag ataccaaata ctgtccttct
     3781 agtgtagccg tagttaggcc accacttcaa gaactctgta gcaccgccta catacctcgc
     3841 tctgctaatc ctgttaccag tggctgctgc cagtggcgat aagtcgtgtc ttaccgggtt
     3901 ggactcaaga cgatagttac cggataaggc gcagcggtcg ggctgaacgg ggggttcgtg
     3961 cacacagccc agcttggagc gaacgaccta caccgaactg agatacctac agcgtgagct
     4021 atgagaaagc gccacgcttc ccgaagggag aaaggcggac aggtatccgg taagcggcag
     4081 ggtcggaaca ggagagcgca cgagggagct tccaggggga aacgcctggt atctttatag
     4141 tcctgtcggg tttcgccacc tctgacttga gcgtcgattt ttgtgatgct cgtcaggggg
     4201 gcggagccta tggaaaaacg ccagcaacgc ggccttttta cggttcctgg ccttttgctg
     4261 gccttttgct cacatgttct ttcctgcgtt atcccctgat tctgtggata accgtattac
     4321 cgcc

Product is for research use only!

Search name

pCMV-Tag 2B,Plasmid pCMV-Tag 2B,pCMV-Tag 2B vector

No customer comments for the moment.

Add A Comment

Related Products


No products

Total $0.00

Prices don't include postage.
