pCMV- Tag 2B Plasmid


  • Model: PVT1027
  • 50 Units in Stock
Ask a question

Add to Cart:

pCMV-Tag 2B

Search name

pCMV-Tag 2B,Plasmid pCMV-Tag 2B,pCMV-Tag 2B vector


pCMV-Tag 2B Information

Promoter: CMV

Replicator: pUC ori, F1 ori

Terminator: SV40 poly (A) signal, HSV-TK poly (A)

Plasmid classification: mammalian cell carrier; protein overexpression plasmid.

Plasmid size: 4324bp

Plasmid label: N-Flag

Prokaryotic resistance: kanamycin Kan

Screening markers: neomycin Neo

Cloned strain: XL1-Blue

Culture conditions: 37 centigrade, aerobic, LB

Expression host: mammalian cells

Culture conditions: 37 centigrade, aerobic, LB

5'sequencing primers: T3: AATTAACCCTCACTAAAGGG

3'sequencing primers: T7: GTAATACGACTCACTATAGGGC


pCMV-Tag 2B Description



pCMV-Tag 2B Sequence

LOCUS       Exported                4324 bp ds-DNA    circular SYN 05-11-2015
KEYWORDS    Untitled 5
SOURCE      synthetic DNA construct
  ORGANISM  synthetic DNA construct
REFERENCE   1  (bases 1 to 4324)
  AUTHORS   admin
  TITLE     Direct Submission
  JOURNAL   Exported 2015-11-5   
FEATURES             Location/Qualifiers
     source          1..4324
                     /organism="synthetic DNA construct"
                     /mol_type="other DNA"
     enhancer        67..370
                     /note="CMV enhancer"
                     /note="human cytomegalovirus immediate early enhancer"
     promoter        371..574
                     /note="CMV promoter"
                     /note="human cytomegalovirus (CMV) immediate early
     promoter        620..638
                     /note="T3 promoter"
                     /note="promoter for bacteriophage T3 RNA polymerase"
     CDS             682..705
                     /product="FLAG(R) epitope tag, followed by an enterokinase
                     cleavage site"
     primer_bind     complement(753..769)
                     /note="KS primer"
                     /note="common sequencing primer, one of multiple similar
     promoter        complement(826..844)
                     /note="T7 promoter"
                     /note="promoter for bacteriophage T7 RNA polymerase"
     polyA_signal    1118..1239
                     /note="SV40 poly(A) signal"
                     /note="SV40 polyadenylation signal"
     rep_origin      complement(1246..1701)
                     /note="f1 ori"
                     /note="f1 bacteriophage origin of replication; arrow
                     indicates direction of (+) strand synthesis"
     promoter        1728..1832
                     /note="AmpR promoter"
     promoter        1834..2191
                     /note="SV40 promoter"
                     /note="SV40 enhancer and early promoter"
     rep_origin      2042..2177
                     /note="SV40 ori"
                     /note="SV40 origin of replication"
     CDS             2226..3020
                     /gene="aph(3')-II (or nptII)"
                     /product="aminoglycoside phosphotransferase from Tn5"
                     /note="confers resistance to neomycin, kanamycin, and G418
     polyA_signal    3252..3299
                     /note="HSV TK poly(A) signal"
                     /note="herpesvirus thymidine kinase polyadenylation signal"
     rep_origin      3628..4216
                     /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of
        1 atgcattagt tattaatagt aatcaattac ggggtcatta gttcatagcc catatatgga
       61 gttccgcgtt acataactta cggtaaatgg cccgcctggc tgaccgccca acgacccccg
      121 cccattgacg tcaataatga cgtatgttcc catagtaacg ccaataggga ctttccattg
      181 acgtcaatgg gtggagtatt tacggtaaac tgcccacttg gcagtacatc aagtgtatca
      241 tatgccaagt acgcccccta ttgacgtcaa tgacggtaaa tggcccgcct ggcattatgc
      301 ccagtacatg accttatggg actttcctac ttggcagtac atctacgtat tagtcatcgc
      361 tattaccatg gtgatgcggt tttggcagta catcaatggg cgtggatagc ggtttgactc
      421 acggggattt ccaagtctcc accccattga cgtcaatggg agtttgtttt ggcaccaaaa
      481 tcaacgggac tttccaaaat gtcgtaacaa ctccgcccca ttgacgcaaa tgggcggtag
      541 gcgtgtacgg tgggaggtct atataagcag agctggttta gtgaaccgtc agatccgcta
      601 gcgattacgc caagctcgaa attaaccctc actaaaggga acaaaagctg gagctccacc
      661 gcggtggcgg ccgccaccat ggattacaag gatgacgacg ataagagccc gggcggatcc
      721 cccgggctgc aggaattcga tatcaagctt atcgataccg tcgacctcga gggggggccc
      781 ggtaccttaa ttaattaagg taccaggtaa gtgtacccaa ttcgccctat agtgagtcgt
      841 attacaattc actcgatcgc ccttcccaac agttgcgcag cctgaatggc gaatggagat
      901 ccaattttta agtgtataat gtgttaaact actgattcta attgtttgtg tattttagat
      961 tcacagtccc aaggctcatt tcaggcccct cagtcctcac agtctgttca tgatcataat
     1021 cagccatacc acatttgtag aggttttact tgctttaaaa aacctcccac acctccccct
     1081 gaacctgaaa cataaaatga atgcaattgt tgttgttaac ttgtttattg cagcttataa
     1141 tggttacaaa taaagcaata gcatcacaaa tttcacaaat aaagcatttt tttcactgca
     1201 ttctagttgt ggtttgtcca aactcatcaa tgtatcttaa cgcgtaaatt gtaagcgtta
     1261 atattttgtt aaaattcgcg ttaaattttt gttaaatcag ctcatttttt aaccaatagg
     1321 ccgaaatcgg caaaatccct tataaatcaa aagaatagac cgagataggg ttgagtgttg
     1381 ttccagtttg gaacaagagt ccactattaa agaacgtgga ctccaacgtc aaagggcgaa
     1441 aaaccgtcta tcagggcgat ggcccactac gtgaaccatc accctaatca agttttttgg
     1501 ggtcgaggtg ccgtaaagca ctaaatcgga accctaaagg gagcccccga tttagagctt
     1561 gacggggaaa gccggcgaac gtggcgagaa aggaagggaa gaaagcgaaa ggagcgggcg
     1621 ctagggcgct ggcaagtgta gcggtcacgc tgcgcgtaac caccacaccc gccgcgctta
     1681 atgcgccgct acagggcgcg tcaggtggca cttttcgggg aaatgtgcgc ggaaccccta
     1741 tttgtttatt tttctaaata cattcaaata tgtatccgct catgagacaa taaccctgat
     1801 aaatgcttca ataatattga aaaaggaaga atcctgaggc ggaaagaacc agctgtggaa
     1861 tgtgtgtcag ttagggtgtg gaaagtcccc aggctcccca gcaggcagaa gtatgcaaag
     1921 catgcatctc aattagtcag caaccaggtg tggaaagtcc ccaggctccc cagcaggcag
No customer comments for the moment.

Add A Comment

Related Products


No products

Total $0.00

Prices don't include postage.
