pCMV- Tag 3B


  • Model: PVT10713
  • 50 Units in Stock
Ask a question

Add to Cart:

pCMV-Tag 3B

Catalog No. PVT10713
Packing 2ug
Function Mammal expression plasmid
Resistance Kan
Screen Neo/G418
Strain DH5alpha
Culture temperature 37degrees centigrade

Copy high

Promoter: CMV

Replicon: pUC ori, F1 ori

Terminator: SV40 poly (A) signal, HSV-TK poly (A)

Plasmid Classification: Mammalian Cell Vector; Protein Overexpression Plasmid

Plasmid size: 4327 BP

Plasmid label: C-myc Tag

5'Sequencing Primers: T3: AATTAACCCTCACTAAAGG
3'Sequencing primers: T7: GTAATACGACTCACTATAGGC


pCMV-Tag 3B Sites

pCMV-Tag 3B-vector


pCMV-Tag 3B Sequence

LOCUS Exported 4327 bp ds-DNA circular SYN 05-11-2015
KEYWORDS Untitled 6
SOURCE synthetic DNA construct
ORGANISM synthetic DNA construct
REFERENCE 1 (bases 1 to 4327)
TITLE Direct Submission
JOURNAL Exported 2015-11-5
FEATURES Location/Qualifiers
source 1..4327
/organism="synthetic DNA construct"
/mol_type="other DNA"
enhancer 67..370
/note="CMV enhancer"
/note="human cytomegalovirus immediate early enhancer"
promoter 371..574
/note="CMV promoter"
/note="human cytomegalovirus (CMV) immediate early
promoter 620..638
/note="T3 promoter"
/note="promoter for bacteriophage T3 RNA polymerase"
CDS 679..708
/product="Myc (human c-Myc oncogene) epitope tag"
primer_bind complement(756..772)
/note="KS primer"
/note="common sequencing primer, one of multiple similar
promoter complement(829..847)
/note="T7 promoter"
/note="promoter for bacteriophage T7 RNA polymerase"
polyA_signal 1121..1242
/note="SV40 poly(A) signal"
/note="SV40 polyadenylation signal"
rep_origin complement(1249..1704)
/note="f1 ori"
/note="f1 bacteriophage origin of replication; arrow
indicates direction of (+) strand synthesis"
promoter 1731..1835
/note="AmpR promoter"
promoter 1837..2194
/note="SV40 promoter"
/note="SV40 enhancer and early promoter"
rep_origin 2045..2180
/note="SV40 ori"
/note="SV40 origin of replication"
CDS 2229..3023
/gene="aph(3')-II (or nptII)"
/product="aminoglycoside phosphotransferase from Tn5"
/note="confers resistance to neomycin, kanamycin, and G418
polyA_signal 3255..3302
/note="HSV TK poly(A) signal"
/note="herpesvirus thymidine kinase polyadenylation signal"
rep_origin 3631..4219
/note="high-copy-number ColE1/pMB1/pBR322/pUC origin of
1 atgcattagt tattaatagt aatcaattac ggggtcatta gttcatagcc catatatgga
61 gttccgcgtt acataactta cggtaaatgg cccgcctggc tgaccgccca acgacccccg
121 cccattgacg tcaataatga cgtatgttcc catagtaacg ccaataggga ctttccattg
181 acgtcaatgg gtggagtatt tacggtaaac tgcccacttg gcagtacatc aagtgtatca
241 tatgccaagt acgcccccta ttgacgtcaa tgacggtaaa tggcccgcct ggcattatgc
301 ccagtacatg accttatggg actttcctac ttggcagtac atctacgtat tagtcatcgc
361 tattaccatg gtgatgcggt tttggcagta catcaatggg cgtggatagc ggtttgactc
421 acggggattt ccaagtctcc accccattga cgtcaatggg agtttgtttt ggcaccaaaa
481 tcaacgggac tttccaaaat gtcgtaacaa ctccgcccca ttgacgcaaa tgggcggtag
541 gcgtgtacgg tgggaggtct atataagcag agctggttta gtgaaccgtc agatccgcta
601 gcgattacgc caagctcgaa attaaccctc actaaaggga acaaaagctg gagctccacc
661 gcggtggcgg ccgccatgga gcagaaactc atctctgaag aggatctgag cccgggcgga
721 tcccccgggc tgcaggaatt cgatatcaag cttatcgata ccgtcgacct cgaggggggg
781 cccggtacct taattaatta aggtaccagg taagtgtacc caattcgccc tatagtgagt
841 cgtattacaa ttcactcgat cgcccttccc aacagttgcg cagcctgaat ggcgaatgga
901 gatccaattt ttaagtgtat aatgtgttaa actactgatt ctaattgttt gtgtatttta
961 gattcacagt cccaaggctc atttcaggcc cctcagtcct cacagtctgt tcatgatcat
1021 aatcagccat accacatttg tagaggtttt acttgcttta aaaaacctcc cacacctccc
1081 cctgaacctg aaacataaaa tgaatgcaat tgttgttgtt aacttgttta ttgcagctta
1141 taatggttac aaataaagca atagcatcac aaatttcaca aataaagcat ttttttcact
1201 gcattctagt tgtggtttgt ccaaactcat caatgtatct taacgcgtaa attgtaagcg
1261 ttaatatttt gttaaaattc gcgttaaatt tttgttaaat cagctcattt tttaaccaat
1321 aggccgaaat cggcaaaatc ccttataaat caaaagaata gaccgagata gggttgagtg
1381 ttgttccagt ttggaacaag agtccactat taaagaacgt ggactccaac gtcaaagggc
1441 gaaaaaccgt ctatcagggc gatggcccac tacgtgaacc atcaccctaa tcaagttttt
1501 tggggtcgag gtgccgtaaa gcactaaatc ggaaccctaa agggagcccc cgatttagag
1561 cttgacgggg aaagccggcg aacgtggcga gaaaggaagg gaagaaagcg aaaggagcgg
1621 gcgctagggc gctggcaagt gtagcggtca cgctgcgcgt aaccaccaca cccgccgcgc
1681 ttaatgcgcc gctacagggc gcgtcaggtg gcacttttcg gggaaatgtg cgcggaaccc
1741 ctatttgttt atttttctaa atacattcaa atatgtatcc gctcatgaga caataaccct
1801 gataaatgct tcaataatat tgaaaaagga agaatcctga ggcggaaaga accagctgtg
1861 gaatgtgtgt cagttagggt gtggaaagtc cccaggctcc ccagcaggca gaagtatgca
1921 aagcatgcat ctcaattagt cagcaaccag gtgtggaaag tccccaggct ccccagcagg
1981 cagaagtatg caaagcatgc atctcaatta gtcagcaacc atagtcccgc ccctaactcc
2041 gcccatcccg cccctaactc cgcccagttc cgcccattct ccgccccatg gctgactaat
2101 tttttttatt tatgcagagg ccgaggccgc ctcggcctct gagctattcc agaagtagtg
2161 aggaggcttt tttggaggcc taggcttttg caaagatcga tcaagagaca ggatgaggat
2221 cgtttcgcat gattgaacaa gatggattgc acgcaggttc tccggccgct tgggtggaga
2281 ggctattcgg ctatgactgg gcacaacaga caatcggctg ctctgatgcc gccgtgttcc
2341 ggctgtcagc gcaggggcgc ccggttcttt ttgtcaagac cgacctgtcc ggtgccctga
2401 atgaactgca agacgaggca gcgcggctat cgtggctggc cacgacgggc gttccttgcg
2461 cagctgtgct cgacgttgtc actgaagcgg gaagggactg gctgctattg ggcgaagtgc
2521 cggggcagga tctcctgtca tctcaccttg ctcctgccga gaaagtatcc atcatggctg
2581 atgcaatgcg gcggctgcat acgcttgatc cggctacctg cccattcgac caccaagcga
2641 aacatcgcat cgagcgagca cgtactcgga tggaagccgg tcttgtcgat caggatgatc
2701 tggacgaaga acatcagggg ctcgcgccag ccgaactgtt cgccaggctc aaggcgagca
2761 tgcccgacgg cgaggatctc gtcgtgaccc atggcgatgc ctgcttgccg aatatcatgg
2821 tggaaaatgg ccgcttttct ggattcatcg actgtggccg gctgggtgtg gcggaccgct
2881 atcaggacat agcgttggct acccgtgata ttgctgaaga acttggcggc gaatgggctg
2941 accgcttcct cgtgctttac ggtatcgccg ctcccgattc gcagcgcatc gccttctatc
3001 gccttcttga cgagttcttc tgagcgggac tctggggttc gaaatgaccg accaagcgac
3061 gcccaacctg ccatcacgag atttcgattc caccgccgcc ttctatgaaa ggttgggctt
3121 cggaatcgtt ttccgggacg ccggctggat gatcctccag cgcggggatc tcatgctgga
3181 gttcttcgcc caccctaggg ggaggctaac tgaaacacgg aaggagacaa taccggaagg
3241 aacccgcgct atgacggcaa taaaaagaca gaataaaacg cacggtgttg ggtcgtttgt
3301 tcataaacgc ggggttcggt cccagggctg gcactctgtc gataccccac cgagacccca
3361 ttggggccaa tacgcccgcg tttcttcctt ttccccaccc caccccccaa gttcgggtga
3421 aggcccaggg ctcgcagcca acgtcggggc ggcaggccct gccatagcct caggttactc
3481 atatatactt tagattgatt taaaacttca tttttaattt aaaaggatct aggtgaagat
3541 cctttttgat aatctcatga ccaaaatccc ttaacgtgag ttttcgttcc actgagcgtc
3601 agaccccgta gaaaagatca aaggatcttc ttgagatcct ttttttctgc gcgtaatctg
3661 ctgcttgcaa acaaaaaaac caccgctacc agcggtggtt tgtttgccgg atcaagagct
3721 accaactctt tttccgaagg taactggctt cagcagagcg cagataccaa atactgtcct
3781 tctagtgtag ccgtagttag gccaccactt caagaactct gtagcaccgc ctacatacct
3841 cgctctgcta atcctgttac cagtggctgc tgccagtggc gataagtcgt gtcttaccgg
3901 gttggactca agacgatagt taccggataa ggcgcagcgg tcgggctgaa cggggggttc
3961 gtgcacacag cccagcttgg agcgaacgac ctacaccgaa ctgagatacc tacagcgtga
4021 gctatgagaa agcgccacgc ttcccgaagg gagaaaggcg gacaggtatc cggtaagcgg
4081 cagggtcgga acaggagagc gcacgaggga gcttccaggg ggaaacgcct ggtatcttta
4141 tagtcctgtc gggtttcgcc acctctgact tgagcgtcga tttttgtgat gctcgtcagg
4201 ggggcggagc ctatggaaaa acgccagcaa cgcggccttt ttacggttcc tggccttttg
4261 ctggcctttt gctcacatgt tctttcctgc gttatcccct gattctgtgg ataaccgtat

No customer comments for the moment.

Add A Comment

Related Products


No products

Total $0.00

Prices don't include postage.
