pCMV-dCpf1-BE0 Plasmid

$216.00

  • Model: PVT17097
  • 20 Units in Stock
Ask a question


Add to Cart:

pCMV-dCpf1-BE0 Plasmid

PVT17097   2ug

 

pCMV-dCpf1-BE0 Plasmid Alternative Name
pCMV-APOBEC1-XTEN-dLbCpf1(D832A/E1006A/D1125A)-SV40NLS-SGGS-UGI-SV40NLS

 

pCMV-dCpf1-BE0 Plasmid Information

Promoter CMV

Prokaryotic resistance Amp

Screening marker

Clone strain Stbl3

Culture Conditions LB/37 Celsius degree

Forward primer

Reverse primer

 

pCMV-dCpf1-BE0 Plasmid Description

pCMV-dCpf1-BE0 Plasmid is a Lactation editing plasmid

 

pCMV-dCpf1-BE0 Plasmid Sequence

CGTTTTGCGCTGCTTCGCGATGTACGGGCCAGATATACGCGTTGACATTGATTATTGACTAGTTATTAATAGTAATCAAT
TACGGGGTCATTAGTTCATAGCCCATATATGGAGTTCCGCGTTACATAACTTACGGTAAATGGCCCGCCTGGCTGACCGC
CCAACGACCCCCGCCCATTGACGTCAATAATGACGTATGTTCCCATAGTAACGCCAATAGGGACTTTCCATTGACGTCAA
TGGGTGGAGTATTTACGGTAAACTGCCCACTTGGCAGTACATCAAGTGTATCATATGCCAAGTACGCCCCCTATTGACGT
CAATGACGGTAAATGGCCCGCCTGGCATTATGCCCAGTACATGACCTTATGGGACTTTCCTACTTGGCAGTACATCTACG
TATTAGTCATCGCTATTACCATGGTGATGCGGTTTTGGCAGTACATCAATGGGCGTGGATAGCGGTTTGACTCACGGGGA
TTTCCAAGTCTCCACCCCATTGACGTCAATGGGAGTTTGTTTTGGCACCAAAATCAACGGGACTTTCCAAAATGTCGTAA
CAACTCCGCCCCATTGACGCAAATGGGCGGTAGGCGTGTACGGTGGGAGGTCTATATAAGCAGAGCTGGTTTAGTGAACC
GTCAGATCCGCTAGAGATCCGCGGCCGCTAATACGACTCACTATAGGGAGAGCCGCCACCATGAGCTCAGAGACTGGCCC
AGTGGCTGTGGACCCCACATTGAGACGGCGGATCGAGCCCCATGAGTTTGAGGTATTCTTCGATCCGAGAGAGCTCCGCA
AGGAGACCTGCCTGCTTTACGAAATTAATTGGGGGGGCCGGCACTCCATTTGGCGACATACATCACAGAACACTAACAAG
CACGTCGAAGTCAACTTCATCGAGAAGTTCACGACAGAAAGATATTTCTGTCCGAACACAAGGTGCAGCATTACCTGGTT
TCTCAGCTGGAGCCCATGCGGCGAATGTAGTAGGGCCATCACTGAATTCCTGTCAAGGTATCCCCACGTCACTCTGTTTA
TTTACATCGCAAGGCTGTACCACCACGCTGACCCCCGCAATCGACAAGGCCTGCGGGATTTGATCTCTTCAGGTGTGACT
ATCCAAATTATGACTGAGCAGGAGTCAGGATACTGCTGGAGAAACTTTGTGAATTATAGCCCGAGTAATGAAGCCCACTG
GCCTAGGTATCCCCATCTGTGGGTACGACTGTACGTTCTTGAACTGTACTGCATCATACTGGGCCTGCCTCCTTGTCTCA
ACATTCTGAGAAGGAAGCAGCCACAGCTGACATTCTTTACCATCGCTCTTCAGTCTTGTCATTACCAGCGACTGCCCCCA
CACATTCTCTGGGCCACCGGGTTGAAAAGCGGCAGCGAGACTCCCGGGACCTCAGAGTCCGCCACACCCGAAAGTATGTC
AAAGCTGGAGAAATTCACCAACTGTTATAGCCTGTCTAAGACCCTGCGCTTCAAGGCAATCCCAGTGGGCAAGACACAAG
AGAACATTGACAACAAACGGCTCCTGGTGGAGGATGAGAAGAGGGCTGAAGATTACAAGGGCGTTAAGAAGCTGCTGGAT
AGGTACTATCTGTCATTCATCAACGATGTCCTCCACAGTATCAAGCTGAAGAATCTGAACAATTACATTTCTCTGTTCCG
GAAGAAGACACGGACCGAGAAGGAGAACAAAGAGCTGGAGAATCTGGAGATCAACCTGAGGAAAGAAATAGCTAAGGCTT
TCAAAGGGAACGAGGGTTACAAGTCCCTGTTCAAGAAAGACATTATCGAGACTATTCTGCCTGAGTTCCTGGACGATAAA
GATGAGATCGCCCTCGTCAATTCCTTCAATGGGTTTACCACAGCCTTTACCGGCTTCTTCGACAATAGAGAGAATATGTT
CTCTGAAGAGGCCAAATCCACTAGCATCGCCTTTCGCTGCATAAACGAGAACCTGACTAGGTACATCAGCAATATGGACA
TCTTTGAGAAAGTCGATGCCATATTCGACAAACATGAGGTGCAGGAGATTAAGGAGAAGATCCTGAACTCAGATTACGAT
GTCGAAGATTTCTTCGAGGGAGAGTTCTTCAACTTCGTGCTCACACAAGAGGGCATTGATGTGTACAATGCAATCATTGG
AGGGTTCGTGACAGAGAGTGGCGAGAAGATAAAGGGCCTGAACGAGTATATCAACCTCTACAACCAGAAAACCAAGCAGA
AACTGCCTAAGTTCAAGCCACTGTACAAACAAGTGCTCTCAGATAGGGAAAGCCTGAGCTTCTACGGTGAAGGGTATACA
TCAGATGAAGAAGTGCTCGAAGTGTTCCGCAACACCCTCAATAAGAACAGTGAAATCTTCTCTTCAATCAAGAAGCTGGA
GAAACTGTTCAAGAATTTCGATGAGTACTCCTCTGCCGGAATCTTTGTGAAGAATGGCCCTGCAATATCCACTATTAGCA
AAGACATCTTTGGCGAGTGGAACGTTATCAGGGATAAGTGGAATGCCGAGTACGATGATATTCATCTCAAGAAGAAAGCC
GTGGTTACAGAGAAATACGAGGATGATAGACGCAAGAGCTTTAAGAAGATTGGTAGCTTCTCTCTCGAACAGCTGCAGGA
GTACGCCGACGCTGACCTGTCAGTCGTGGAGAAACTCAAGGAGATCATAATCCAGAAGGTGGATGAAATCTACAAAGTGT
ATGGAAGCTCTGAGAAACTCTTCGATGCAGACTTTGTTCTGGAGAAGAGTCTGAAGAAGAACGACGCAGTGGTTGCTATC
ATGAAGGACCTGCTGGATTCTGTTAAGTCTTTCGAGAATTACATTAAGGCATTCTTTGGTGAAGGGAAGGAGACAAATAG
GGACGAGAGCTTCTATGGCGACTTTGTTCTGGCCTACGACATCCTCCTCAAGGTTGACCACATCTATGACGCTATACGGA
ATTACGTTACCCAGAAGCCCTATAGCAAAGACAAGTTCAAGCTGTATTTCCAGAATCCACAGTTTATGGGTGGGTGGGAT
AAAGACAAAGAAACAGATTACAGGGCCACTATCCTGCGGTACGGCAGCAAATACTATCTGGCTATCATGGATAAGAAGTA
CGCCAAATGCCTCCAGAAGATCGACAAGGACGACGTGAACGGTAACTACGAGAAGATCAATTACAAGCTCCTGCCAGGAC
CTAACAAGATGCTGCCCAAGGTGTTCTTCTCCAAGAAATGGATGGCCTACTATAACCCAAGCGAGGACATTCAGAAGATA
TACAAGAATGGGACATTCAAGAAGGGCGATATGTTCAACCTCAACGACTGCCACAAGCTGATTGATTTCTTCAAGGATAG
CATTTCTCGCTATCCCAAGTGGTCTAATGCATACGATTTCAACTTCAGCGAGACTGAGAAGTACAAAGACATCGCTGGCT
TCTACCGGGAGGTGGAAGAGCAAGGCTATAAGGTGTCATTCGAATCCGCTTCTAAGAAGGAAGTGGATAAGCTCGTGGAA
GAGGGTAAGCTGTACATGTTCCAGATATACAACAAAGACTTCAGCGATAAGAGCCACGGCACTCCAAACCTCCATACTAT
GTATTTCAAGCTGCTGTTTGACGAGAACAACCACGGACAGATTAGGCTGTCAGGAGGCGCAGAACTCTTCATGCGCAGAG
CTTCACTGAAGAAGGAGGAACTCGTTGTCCACCCAGCCAATAGCCCTATAGCCAATAAGAATCCAGACAATCCTAAGAAA
ACCACTACTCTGTCTTACGATGTGTATAAGGATAAGAGATTCTCTGAAGATCAGTACGAACTGCACATACCCATTGCCAT
TAACAAGTGCCCTAAGAACATCTTCAAGATTAACACAGAGGTTAGAGTGCTCCTGAAACACGACGATAACCCTTATGTTA
TAGGCATTGCTCGCGGAGAGAGAAACCTGCTGTACATCGTCGTGGTGGACGGCAAAGGCAACATCGTGGAACAGTACAGT
CTCAATGAAATCATTAACAATTTCAACGGAATCCGCATTAAGACCGACTACCATTCTCTCCTCGACAAGAAGGAGAAAGA
AAGGTTCGAAGCAAGACAGAATTGGACAAGTATAGAGAATATCAAAGAACTGAAGGCTGGGTACATCTCTCAGGTTGTGC
ACAAGATATGTGAGCTGGTGGAGAAGTACGACGCTGTTATCGCCCTCGCGGACCTGAATAGCGGCTTCAAGAACTCCAGG
GTGAAGGTGGAGAAGCAGGTGTATCAGAAGTTCGAGAAGATGCTGATCGACAAGCTCAACTATATGGTGGACAAGAAATC
CAATCCTTGCGCTACTGGTGGAGCCCTGAAGGGCTATCAAATCACCAATAAGTTCGAATCTTTCAAGTCTATGAGCACCC
AGAATGGCTTCATCTTCTACATACCCGCATGGCTGACATCCAAGATTGATCCCTCTACCGGATTTGTTAATCTGCTCAAG
ACTAAGTACACCTCTATTGCTGACTCAAAGAAGTTCATATCATCATTTGACCGCATCATGTACGTGCCAGAAGAGGACCT
GTTCGAGTTTGCCCTGGATTACAAGAATTTCTCTCGGACTGACGCCGACTACATCAAGAAGTGGAAGCTCTACTCTTATG
GTAATCGGATTCGCATATTCCGCAATCCCAAGAAGAATAACGTGTTCGATTGGGAGGAAGTTTGCCTCACCAGCGCTTAC
AAGGAGCTGTTCAATAAGTATGGGATTAACTACCAGCAGGGCGACATAAGAGCCCTGCTGTGCGAACAATCTGATAAGGC
ATTCTATTCCTCTTTCATGGCACTGATGTCACTGATGCTGCAAATGCGCAATTCCATCACCGGAAGAACAGACGTGGCCT
TTCTGATCTCTCCTGTCAAGAACTCAGATGGCATCTTCTACGATTCCCGCAACTATGAAGCACAGGAGAATGCTATCCTG
CCTAAGAATGCCGATGCAAATGGAGCCTATAACATCGCCAGAAAGGTCCTCTGGGCCATAGGACAATTCAAGAAAGCTGA
AGATGAGAAGCTGGACAAGGTGAAGATCGCCATTTCAAACAAAGAGTGGCTCGAATATGCTCAGACCTCAGTGAAGCATG
GATCACCCAAGAAGAAACGGAAAGTGTCTGGTGGTTCTACTAATCTGTCAGATATTATTGAAAAGGAGACCGGTAAGCAA
CTGGTTATCCAGGAATCCATCCTCATGCTCCCAGAGGAGGTGGAAGAAGTCATTGGGAACAAGCCGGAAAGCGATATACT
CGTGCACACCGCCTACGACGAGAGCACCGACGAGAATGTCATGCTTCTGACTAGCGACGCCCCTGAATACAAGCCTTGGG
CTCTGGTCATACAGGATAGCAACGGTGAGAACAAGATTAAGATGCTCTCTGGTGGTTCTCCCAAGAAGAAGAGGAAAGTC
TAACCGGTCATCATCACCATCACCATTGAGTTTAAACCCGCTGATCAGCCTCGACTGTGCCTTCTAGTTGCCAGCCATCT
GTTGTTTGCCCCTCCCCCGTGCCTTCCTTGACCCTGGAAGGTGCCACTCCCACTGTCCTTTCCTAATAAAATGAGGAAAT
TGCATCGCATTGTCTGAGTAGGTGTCATTCTATTCTGGGGGGTGGGGTGGGGCAGGACAGCAAGGGGGAGGATTGGGAAG
ACAATAGCAGGCATGCTGGGGATGCGGTGGGCTCTATGGCTTCTGAGGCGGAAAGAACCAGCTGGGGCTCGATACCGTCG
ACCTCTAGCTAGAGCTTGGCGTAATCATGGTCATAGCTGTTTCCTGTGTGAAATTGTTATCCGCTCACAATTCCACACAA
CATACGAGCCGGAAGCATAAAGTGTAAAGCCTAGGGTGCCTAATGAGTGAGCTAACTCACATTAATTGCGTTGCGCTCAC
TGCCCGCTTTCCAGTCGGGAAACCTGTCGTGCCAGCTGCATTAATGAATCGGCCAACGCGCGGGGAGAGGCGGTTTGCGT
ATTGGGCGCTCTTCCGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGGCTGCGGCGAGCGGTATCAGCTCACTC
AAAGGCGGTAATACGGTTATCCACAGAATCAGGGGATAACGCAGGAAAGAACATGTGAGCAAAAGGCCAGCAAAAGGCCA
GGAACCGTAAAAAGGCCGCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGACGCTCA
AGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAAGCTCCCTCGTGCGCTCTCCTGT
TCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGGAAGCGTGGCGCTTTCTCATAGCTCACGCTGTA
GGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCTGGGCTGTGTGCACGAACCCCCCGTTCAGCCCGACCGCTGCGCC
TTATCCGGTAACTATCGTCTTGAGTCCAACCCGGTAAGACACGACTTATCGCCACTGGCAGCAGCCACTGGTAACAGGAT
TAGCAGAGCGAGGTATGTAGGCGGTGCTACAGAGTTCTTGAAGTGGTGGCCTAACTACGGCTACACTAGAAGAACAGTAT
TTGGTATCTGCGCTCTGCTGAAGCCAGTTACCTTCGGAAAAAGAGTTGGTAGCTCTTGATCCGGCAAACAAACCACCGCT
GGTAGCGGTGGTTTTTTTGTTTGCAAGCAGCAGATTACGCGCAGAAAAAAAGGATCTCAAGAAGATCCTTTGATCTTTTC
TACGGGGTCTGACGCTCAGTGGAACGAAAACTCACGTTAAGGGATTTTGGTCATGAGATTATCAAAAAGGATCTTCACCT
AGATCCTTTTAAATTAAAAATGAAGTTTTAAATCAATCTAAAGTATATATGAGTAAACTTGGTCTGACAGTTACCAATGC
TTAATCAGTGAGGCACCTATCTCAGCGATCTGTCTATTTCGTTCATCCATAGTTGCCTGACTCCCCGTCGTGTAGATAAC
TACGATACGGGAGGGCTTACCATCTGGCCCCAGTGCTGCAATGATACCGCGAGACCCACGCTCACCGGCTCCAGATTTAT
CAGCAATAAACCAGCCAGCCGGAAGGGCCGAGCGCAGAAGTGGTCCTGCAACTTTATCCGCCTCCATCCAGTCTATTAAT
TGTTGCCGGGAAGCTAGAGTAAGTAGTTCGCCAGTTAATAGTTTGCGCAACGTTGTTGCCATTGCTACAGGCATCGTGGT
GTCACGCTCGTCGTTTGGTATGGCTTCATTCAGCTCCGGTTCCCAACGATCAAGGCGAGTTACATGATCCCCCATGTTGT
GCAAAAAAGCGGTTAGCTCCTTCGGTCCTCCGATCGTTGTCAGAAGTAAGTTGGCCGCAGTGTTATCACTCATGGTTATG
GCAGCACTGCATAATTCTCTTACTGTCATGCCATCCGTAAGATGCTTTTCTGTGACTGGTGAGTACTCAACCAAGTCATT
CTGAGAATAGTGTATGCGGCGACCGAGTTGCTCTTGCCCGGCGTCAATACGGGATAATACCGCGCCACATAGCAGAACTT
TAAAAGTGCTCATCATTGGAAAACGTTCTTCGGGGCGAAAACTCTCAAGGATCTTACCGCTGTTGAGATCCAGTTCGATG
TAACCCACTCGTGCACCCAACTGATCTTCAGCATCTTTTACTTTCACCAGCGTTTCTGGGTGAGCAAAAACAGGAAGGCA
AAATGCCGCAAAAAAGGGAATAAGGGCGACACGGAAATGTTGAATACTCATACTCTTCCTTTTTCAATATTATTGAAGCA
TTTATCAGGGTTATTGTCTCATGAGCGGATACATATTTGAATGTATTTAGAAAAATAAACAAATAGGGGTTCCGCGCACA
TTTCCCCGAAAAGTGCCACCTGACGTCGACGGATCGGGAGATCGATCTCCCGATCCCCTAGGGTCGACTCTCAGTACAAT
CTGCTCTGATGCCGCATAGTTAAGCCAGTATCTGCTCCCTGCTTGTGTGTTGGAGGTCGCTGAGTAGTGCGCGAGCAAAA
TTTAAGCTACAACAAGGCAAGGCTTGACCGACAATTGCATGAAGAATCTGCTTAGGGTTAGG

//
 

NOTE: For research use only!

No customer comments for the moment.

Add A Comment

Related Products

Cart  

No products

Total $0.00

Prices don't include postage.

Cart