pCMV-HA-N

$280.00

  • Model: PVTY00955
  • 20 Units in Stock
Ask a question


Add to Cart:

pCMV-HA-N

PVTY00955  2ug

pCMV-HA-N Description

Plasmid type: Mammalian expression vector Copy Number: High copy Promoter: CMV Cloning Method: Multiple cloning sites,restriction endonuclease Size: 3782 bp 5' Sequencing primers and sequences: pCMV-F: 5'd[GATCCGGTACTAGAGGAACTGAAAAAC]3' Tags: HA Resistance(s): Ampicillin (Amp)

Caution:
1.  This product is FOR RESEARCH USE ONLY!

No customer comments for the moment.

Add A Comment

Related Products

Cart  

No products

Total $0.00

Prices don't include postage.

Cart