pCMV-SPORT6-C1GALT1C1

$162.00

  • Model: PVT18958
  • 50 Units in Stock
Ask a question


Add to Cart:

pCMV-SPORT6-C1GALT1C1

 

Product Name: pCMV-SPORT6-C1GALT1C1
Cat No.: PVT18958
Alternative Name: pCMV-SPORT6-C1GALT1C1,pCMV-SPORT6-C1GALT1C1 vector,pCMV-SPORT6-C1GALT1C1 plasmid,pCMV-SPORT6-C1GALT1C1 map,pCMV-SPORT6-C1GALT1C1 sequence
Plasmid form: Freeze-dried powder
Storage Condition: -20 Centigrade
Bulk order Please contact us: sales@lifescience-market.com
Promoter: -
Bacterial Resistance(s): Amp
Screening: -
Growth Strain(s): DH5alpha
Culture Medium: LB
Temperature: 37 Centigrade
Vector Size: 957bp

 

pCMV-SPORT6-C1GALT1C1 Sequence

Homo sapiens C1GALT1 specific chaperone 1 (C1GALT1C1), transcript variant 2, mRNA
NCBI Reference Sequence: NM_001011551.3;BC050441.1


gene="C1GALT1C1"
                     /gene_synonym="C1GALT2; C38H2-L1; COSMC; HSPC067; MST143;TNPS"


atgctttctgaaagcagctcctttttgaagggtgtgatgcttggaagcattttctgtgctttgatcactatgctaggacacattaggattggtcatggaaatagaatgcaccaccatgagcatcatcacctacaagctcctaacaaagaagatatcttgaaaatttcagaggatgagcgcatggagctcagtaagagctttcgagtatactgtattatccttgtaaaacccaaagatgtgagtctttgggctgcagtaaaggagacttggaccaaacactgtgacaaagcagagttcttcagttctgaaaatgttaaagtgtttgagtcaattaatatggacacaaatgacatgtggttaatgatgagaaaagcttacaaatacgcctttgataagtatagagaccaatacaactggttcttccttgcacgccccactacgtttgctatcattgaaaacctaaagtattttttgttaaaaaaggatccatcacagcctttctatctaggccacactataaaatctggagaccttgaatatgtgggtatggaaggaggaattgtcttaagtgtagaatcaatgaaaagacttaacagccttctcaatatcccagaaaagtgtcctgaacagggagggatgatttggaagatatctgaagataaacagctagcagtttgcctgaaatatgctggagtatttgcagaaaatgcagaagatgctgatggaaaagatgtatttaataccaaatctgttgggctttctattaaagaggcaatgacttatcaccccaaccaggtagtagaaggctgttgttcagatatggctgttacttttaatggactgactccaaatcagatgcatgtgatgatgtatggggtataccgccttagggcatttgggcatattttcaatgatgcattggttttcttacctccaaatggttctgacaatgactga

//

 

*Product is for research use only!

No customer comments for the moment.

Add A Comment

Related Products

Cart  

No products

Total $0.00

Prices don't include postage.

Cart