pCMV-SPORT6-CYP1A1 Plasmid

$216.00

  • Model: PVT16253
  • 20 Units in Stock
Ask a question


Add to Cart:

pCMV-SPORT6-CYP1A1 Plasmid

PVT16253   2ug

 

pCMV-SPORT6-CYP1A1 Plasmid Alternative Name
NM_001319217.2,AHH, AHRR, CP11, CYP1, CYPIA1, P1-450,P450-C, P450DX

 

pCMV-SPORT6-CYP1A1 Plasmid Information

Promoter

Prokaryotic resistance Amp

Screening marker

Clone strain DH5a

Culture Conditions LB/37 Celsius degree

Forward primer SP6

Reverse primer T7

 

pCMV-SPORT6-CYP1A1 Plasmid Description

pCMV-SPORT6-CYP1A1 Plasmid is a DNA cloning plasmid

 

CYP1A1 Sequence
 

Homo sapiens cytochrome P450 family 1 subfamily A member 1 (CYP1A1), transcript variant 3, mRNA
NCBI Reference Sequence: NM_001319217.2


 /gene="CYP1A1"
                     /gene_synonym="AHH; AHRR; CP11; CYP1; CYPIA1; P1-450;
                     P450-C; P450DX"

atgcttttcccaatctccatgtcggccacggagtttcttctggcctctgtcatcttctgtctggtattctgggtaatcagggcctcaagacctcaggtccccaaaggcctgaagaatccaccagggccatggggctggcctctgattgggcacatgctgaccctgggaaagaacccgcacctggcactgtcaaggatgagccagcagtatggggacgtgctgcagatccgaattggctccacacccgtggtggtgctgagcggcctggacaccatccggcaggccctggtgcggcagggcgatgatttcaagggccggcccgacctctacaccttcaccctcatcagtaatggtcagagcatgtccttcagcccagactctggaccagtgtgggctgcccgccggcgcctggcccagaatggcctgaaaagtttctccattgcctctgacccagcctcctcaacctcctgctacctggaagagcatgtgagcaaggaggctgaggtcctgataagcacgttgcaggagctgatggcagggcctgggcactttaacccctacaggtatgtggtggtatcagtgaccaatgtcatctgtgccatttgctttggccggcgctatgaccacaaccaccaagaactgcttagcctagtcaacctgaataataatttcggggaggtggttggctctggaaacccagctgacttcatccctattcttcgctacctacccaacccttccctgaatgccttcaaggacctgaatgagaagttctacagcttcatgcagaagatggtcaaggagcactacaaaacctttgagaagggccacatccgggacatcacagacagcctgattgagcactgtcaggagaagcagctggatgagaacgccaatgtccagctgtcagatgagaagatcattaacatcgtcttggacctctttggagctgggtttgacacagtcacaactgctatctcctggagcctcatgtatttggtgatgaaccccagggtacagagaaagatccaagaggagctagacacagtgattggcaggtcacggcggccccggctctctgacagatcccatctgccctatatggaggccttcatcctggagaccttccgacactcttccttcgtccccttcaccatcccccacagcacaacaagagacacaagtttgaaaggcttttacatccccaaggggcgttgtgtctttgtaaaccagtggcagatcaaccatgaccagaagctatgggtcaacccatctgagttcctacctgaacggtttctcacccctgatggtgctatcgacaaggtgttaagtgagaaggtgattatctttggcatgggcaagcggaagtgtatcggtgagaccattgcccgctgggaggtctttctcttcctggctatcctgctgcaacgggtggaattcagcgtgccactgggcgtgaaggtggacatgacccccatctatgggctaaccatgaagcatgcctgctgtgagcacttccaaatgcagctgcgctcttag

//

 

NOTE: For research use only!

No customer comments for the moment.

Add A Comment

Related Products

Cart  

No products

Total $0.00

Prices don't include postage.

Cart