pCMV-SPORT6-ZNF251

$218.00

  • Model: PVT12143
  • 50 Units in Stock
Ask a question


Add to Cart:

pCMV-SPORT6-ZNF251

Cat. PVT12143

Packing 2ug

 

pCMV-SPORT6-ZNF251 Alternative Name

ZNF251

 

pCMV-SPORT6-ZNF251 Information

Product Name: pCMV-SPORT6-ZNF251 vector

Bacterial Resistance: Amp

Selectable markers: /

Growth Strain: DH5alpha

Growth Temperature: LB/37Centigrade degree

 

pCMV-SPORT6-ZNF251 Sequence

CAGATTACCCTCACTAAAGGGACTAGTCCTGCAGGTTTAAACGAATTCGCCCTTCGGTCCAGGGGTTGACTTTCCACTGA
AGGCGTTTCCACATTCTTGACATTTATAGGGCTTTTCCCCAGCATGCATTATCTGATCTTCAGTGGGTCGTGAGGTGGGA
CTGAAAGCTTTTCCATATTCATTACATCCAAAGGATTTCTCACCAGTGTGAACTGTCCAGCGCAGAATGAGATTTGCACC
ATGGTTAAAGGCTCTGCCGTGCTTCTCTCCAGTGGGAATCTGTCCATCTGCTGTGAGGCTGGAGCCATGAACAAAGGCTG
GACCATGTTTTCTGCACTTACGAGTCTCTCCGCTGTGAACTTTCTGATGCTGAATGAGGGTTGACCTCCGGCTGAAGGCC
TTCCCACAGTCACCACAGTCATAGGGCTTCTCTCCAGTGTGAACTCGCTGATGTAGGGTGAGCTGGGAGCTCTGGCTGAA
AGCTTTCCCACATTCAACGCACTGGTAGGGCTTCTCCCCAGTGTGAACTCTTCGATGCTGAACAAGAGTGGAACTCCGAC
GAAAGGCTTTGCCGCACTCATTACAAACATAGGGTTTTTCTCCTGTGTGAATCCTTACGTGTTCAGTAAGATGAGAGTTA
AAACCAAAGGCTCTGCCGCATTCAAGGGCGAATTCGCGGCCGCTAAATTCAATTCGCCCTATAGTGAGTCGTATTACAAT
TCACTGGCCGTCGTTTTACAACGTCGTGACTGGGAAAACCCTGGCGTTACCCAACTTAATCGCCTTGCAGCACATCCCCC
TTTCGCCAGCTGGCGTAATAGCGAAGAGGCCCGCACCGATCGCCCTTCCCAACAGTTGCGCAGCCTATACGTACGGCAGT
TTAAGGTTTACACCTATAAAAGAGAGAGCCGTTATCGTCTGTTTGTGGATGTACAGAGTGATATTATTGACACGCCGGGG
CGACGGATGGTGATCCCCCTGGCCAGTGCACGTCTGCTGTCAGATAAAGTCTCCCGTGAACTTTTACCCGGTGGGTGGCA
T
//

 

Caution:
Product is for research use only!

No customer comments for the moment.

Add A Comment

Related Products

Cart  

No products

Total $0.00

Prices don't include postage.

Cart