pCold I


  • Model: PVT10598
  • 50 Units in Stock
Ask a question

Add to Cart:

pCold I

Catalog No. PVT10598
Packing 2ug


pCold I Information

Function E.coli expression plasmid

Promoter: CspA promoter

Replicator: Ori, F1 ori

Plasmid classification: large intestine plasmid; large intestine expression plasmid; pCold series plasmid.

Plasmid size: 4407bp

Plasmid label: N-His, N-Factor Xa

Prokaryotic resistance: ampicillin Amp (100 u g/ml)

Cloned strains of Escherichia coli, DH5 A and other Escherichia coli

Culture conditions: 37 centigrade, aerobic, LB

Expression of host: BL21 and other Escherichia coli

Culture conditions: 37 centigrade, aerobic, LB

Inducement: IPTG or lactose and its analogues

5'sequencing primers: pCold-F (ACGCCATATCGCCGAAAGG)

3'sequencing primers: pCold-R (GGCAGGGATCTTAGATTCTG)

Remarks: cold start expression plasmid


pCold I Description

When the temperature of the cultured Escherichia coli was reduced, most of the protein expression was reduced almost temporarily, while a group of proteins called "cold shock protein" was specifically induced. The cold shock expression vector, pCold I-IV, uses the cold shock gene CSPA promoter to design an efficient protein expression vector. The lac operon is inserted at the downstream of CSPA promoter to control expression. In addition, the 5'non translation area (5'UTR), the translation enhancement element (TEE), the His tag sequence, the Xa factor cutting site and the polyclonal site (MCS) are located downstream of the CSPA promoter. Most Escherichia coli strains can be used as the host of the product because of the Escherichia coli promoter. There are four types of pCold vectors, the location of their following parts is slightly different, TEE, His tag sequence and Factor XA enzyme site.

PColdI plasmid is designed by using cold shock gene CSPA promoter to design high efficiency protein expression vector. At the downstream of the promoter, lac operon was inserted to control expression. In addition, the 5 'untranslated region (5' UTR), the translation enhancement element (TEE), the His label sequence, the Xa factor cutting site and the polyclonal site (MCS) are located downstream of the CAPS promoter. When the culture temperature was switched to low temperature, the Escherichia coli stopped growing temporarily and most of the Escherichia coli protein expression decreased, but a class of proteins called cold shock proteins were specifically induced.


pCold I Sequence

LOCUS       Exported                4407 bp ds-DNA     circular SYN 13-SEP-2016
DEFINITION  synthetic circular DNA
KEYWORDS    Untitled 3
SOURCE      synthetic DNA construct
  ORGANISM  synthetic DNA construct
REFERENCE   1  (bases 1 to 4407)
  TITLE     Direct Submission
  JOURNAL   Exported Tuesday, September 13, 2016 
FEATURES             Location/Qualifiers
     source          1..4407
                     /organism="synthetic DNA construct"
                     /mol_type="other DNA"
     protein_bind    84..100
                     /bound_moiety="lac repressor encoded by lacI"
                     /note="lac operator"
                     /note="The lac repressor binds to the lac operator to
                     inhibit transcription in E. coli. This inhibition can be
                     relieved by adding lactose or
                     isopropyl-beta-D-thiogalactopyranoside (IPTG)."
     CDS             271..288
                     /product="6xHis affinity tag"
     CDS             289..300
                     /product="Factor Xa recognition and cleavage site"
                     /note="Factor Xa site"
     rep_origin      complement(711..1166)
                     /note="f1 ori"
                     /note="f1 bacteriophage origin of replication; arrow
                     indicates direction of (+) strand synthesis"
     promoter        1266..1370
                     /note="AmpR promoter"
     CDS             1371..2231
                     /note="confers resistance to ampicillin, carbenicillin, and
                     related antibiotics"
     rep_origin      2402..2990
                     /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of
     CDS             complement(3162..4244)
                     /product="lac repressor"
                     /note="The lac repressor binds to the lac operator to
                     inhibit transcription in E. coli. This inhibition can be
                     relieved by adding lactose or
                     isopropyl-beta-D-thiogalactopyranoside (IPTG)."
     promoter        complement(4245..4322)
                     /note="lacI promoter"
        1 aaggaatggt gtggccgatt aatcataaat atgaaaaata attgttgcat cacccgccaa
       61 tgcgtggctt aatgcacatc aaattgtgag cggataacaa tttgatgtgc tagcgcatat
      121 ccagtgtagt aaggcaagtc ccttcaagag ttatcgttga tacccctcgt agtgcacatt
      181 cctttaacgc ttcaaaatct gtaaagcacg ccatatcgcc gaaaggcaca cttaattatt
      241 aagaggtaat acaccatgaa tcacaaagtg catcatcatc atcatcatat cgaaggtagg
      301 catatggagc tcggtaccct cgagggatcc gaattcaagc ttgtcgacct gcagtctaga
      361 taggtaatct ctgcttaaaa gcacagaatc taagatccct gccatttggc ggggattttt
      421 ttatttgttt tcaggaaata aataatcgat cgcgtaataa aatctattat tatttttgtg
      481 aagaataaat ttgggtgcaa tgagaatgcg caggcccttt cgtctcgcgc gtttcggtga
      541 tgacggtgaa aacctctgac acatgcagct cccggagacg gtcacagctt gtctgtaagc
      601 ggatgccggg agcagacaag cccgtcaggg cgcgtcagcg ggtgttggcg ggtgtcgggg
      661 ctggcttaac tatgcggcat cagagcagat tgtactgaga gtgcaccata aaattgtaaa
      721 cgttaatatt ttgttaaaat tcgcgttaaa tttttgttaa atcagctcat tttttaacca
      781 ataggccgaa atcggcaaaa tcccttataa atcaaaagaa tagcccgaga tagggttgag
      841 tgttgttcca gtttggaaca agagtccact attaaagaac gtggactcca acgtcaaagg
      901 gcgaaaaacc gtctatcagg gcgatggccc actacgtgaa ccatcaccca aatcaagttt
      961 tttggggtcg aggtgccgta aagcactaaa tcggaaccct aaagggagcc cccgatttag
     1021 agcttgacgg ggaaagccgg cgaacgtggc gagaaaggaa gggaagaaag cgaaaggagc
     1081 gggcgctagg gcgctggcaa gtgtagcggt cacgctgcgc gtaaccacca cacccgccgc
     1141 gcttaatgcg ccgctacagg gcgcgtacta tggttgcttt gacgtatgcg gtgtgaaata
     1201 ccgcacagat gcgtaaggag aaaataccgc atcaggcgtc aggtggcact tttcggggaa
     1261 atgtgcgcgg aacccctatt tgtttatttt tctaaataca ttcaaatatg tatccgctca
     1321 tgagacaata accctgataa atgcttcaat aatattgaaa aaggaagagt atgagtattc
     1381 aacatttccg tgtcgccctt attccctttt ttgcggcatt ttgccttcct gtttttgctc
     1441 acccagaaac gctggtgaaa gtaaaagatg ctgaagatca gttgggtgca cgagtgggtt
     1501 acatcgaact ggatctcaac agcggtaaga tccttgagag ttttcgcccc gaagaacgtt
     1561 ttccaatgat gagcactttt aaagttctgc tatgtggcgc ggtattatcc cgtattgacg
     1621 ccgggcaaga gcaactcggt cgccgcatac actattctca gaatgacttg gttgagtact
     1681 caccagtcac agaaaagcat cttacggatg gcatgacagt aagagaatta tgcagtgctg
     1741 ccataaccat gagtgataac actgcggcca acttacttct gacaacgatc ggaggaccga
     1801 aggagctaac cgcttttttg cacaacatgg gggatcatgt aactcgcctt gatcgttggg
     1861 aaccggagct gaatgaagcc ataccaaacg acgagcgtga caccacgatg cctgtagcaa
     1921 tggcaacaac gttgcgcaaa ctattaactg gcgaactact tactctagct tcccggcaac
     1981 aattaataga ctggatggag gcggataaag ttgcaggacc acttctgcgc tcggcccttc
     2041 cggctggctg gtttattgct gataaatctg gagccggtga gcgtgggtct cgcggtatca
     2101 ttgcagcact ggggccagat ggtaagccct cccgtatcgt agttatctac acgacgggga
     2161 gtcaggcaac tatggatgaa cgaaatagac agatcgctga gataggtgcc tcactgatta
     2221 agcattggta actgtcagac caagtttact catatatact ttagattgat ttaaaacttc
     2281 atttttaatt taaaaggatc taggtgaaga tcctttttga taatctcatg accaaaatcc
     2341 cttaacgtga gttttcgttc cactgagcgt cagaccccgt agaaaagatc aaaggatctt
     2401 cttgagatcc tttttttctg cgcgtaatct gctgcttgca aacaaaaaaa ccaccgctac
     2461 cagcggtggt ttgtttgccg gatcaagagc taccaactct ttttccgaag gtaactggct
     2521 tcagcagagc gcagatacca aatactgttc ttctagtgta gccgtagtta ggccaccact
     2581 tcaagaactc tgtagcaccg cctacatacc tcgctctgct aatcctgtta ccagtggctg
     2641 ctgccagtgg cgataagtcg tgtcttaccg ggttggactc aagacgatag ttaccggata
     2701 aggcgcagcg gtcgggctga acggggggtt cgtgcacaca gcccagcttg gagcgaacga
     2761 cctacaccga actgagatac ctacagcgtg agctatgaga aagcgccacg cttcccgaag
     2821 ggagaaaggc ggacaggtat ccggtaagcg gcagggtcgg aacaggagag cgcacgaggg
     2881 agcttccagg gggaaacgcc tggtatcttt atagtcctgt cgggtttcgc cacctctgac
     2941 ttgagcgtcg atttttgtga tgctcgtcag gggggcggag cctatggaaa aacgccagca
     3001 acgcggcctt tttacggttc ctggcctttt gctggccttt tgctcacata gtcatgcccc
     3061 gcgcccaccg gaaggagctg actgggttga aggctctcaa gggcatcggt cgagatcccg
     3121 gtgcctaatg agtgagctaa cttacattaa ttgcgttgcg ctcactgccc gctttccagt
     3181 cgggaaacct gtcgtgccag ctgcattaat gaatcggcca acgcgcgggg agaggcggtt
     3241 tgcgtattgg gcgccagggt ggtttttctt ttcaccagtg agacgggcaa cagctgattg
     3301 cccttcaccg cctggccctg agagagttgc agcaagcggt ccacgctggt ttgccccagc
     3361 aggcgaaaat cctgtttgat ggtggttaac ggcgggatat aacatgagct gtcttcggta
     3421 tcgtcgtatc ccactaccga gatatccgca ccaacgcgca gcccggactc ggtaatggcg
     3481 cgcattgcgc ccagcgccat ctgatcgttg gcaaccagca tcgcagtggg aacgatgccc
     3541 tcattcagca tttgcatggt ttgttgaaaa ccggacatgg cactccagtc gccttcccgt
     3601 tccgctatcg gctgaatttg attgcgagtg agatatttat gccagccagc cagacgcaga
     3661 cgcgccgaga cagaacttaa tgggcccgct aacagcgcga tttgctggtg acccaatgcg
     3721 accagatgct ccacgcccag tcgcgtaccg tcttcatggg agaaaataat actgttgatg
     3781 ggtgtctggt cagagacatc aagaaataac gccggaacat tagtgcaggc agcttccaca
     3841 gcaatggcat cctggtcatc cagcggatag ttaatgatca gcccactgac gcgttgcgcg
     3901 agaagattgt gcaccgccgc tttacaggct tcgacgccgc ttcgttctac catcgacacc
     3961 accacgctgg cacccagttg atcggcgcga gatttaatcg ccgcgacaat ttgcgacggc
     4021 gcgtgcaggg ccagactgga ggtggcaacg ccaatcagca acgactgttt gcccgccagt
     4081 tgttgtgcca cgcggttggg aatgtaattc agctccgcca tcgccgcttc cactttttcc
     4141 cgcgttttcg cagaaacgtg gctggcctgg ttcaccacgc gggaaacggt ctgataagag
     4201 acaccggcat actctgcgac atcgtataac gttactggtt tcacattcac caccctgaat
     4261 tgactctctt ccgggcgcta tcatgccata ccgcgaaagg ttttgcgcca ttcgatggtg
     4321 tccgggatct cgacgctctc ccttatgcga ctcctgcatt aggaagcagc ccagtagtag
     4381 gttgaggccg ttgagcaccg ccgccgc
No customer comments for the moment.

Add A Comment

Related Products


No products

Total $0.00

Prices don't include postage.
