pCold I

Catalog No. PVT10598
Packing 2ug

 

pCold I Information

Function E.coli expression plasmid

Promoter: CspA promoter

Replicator: Ori, F1 ori

Plasmid classification: large intestine plasmid; large intestine expression plasmid; pCold series plasmid.

Plasmid size: 4407bp

Plasmid label: N-His, N-Factor Xa

Prokaryotic resistance: ampicillin Amp (100 u g/ml)

Cloned strains of Escherichia coli, DH5 A and other Escherichia coli

Culture conditions: 37 centigrade, aerobic, LB

Expression of host: BL21 and other Escherichia coli

Culture conditions: 37 centigrade, aerobic, LB

Inducement: IPTG or lactose and its analogues

5'sequencing primers: pCold-F (ACGCCATATCGCCGAAAGG)

3'sequencing primers: pCold-R (GGCAGGGATCTTAGATTCTG)

Remarks: cold start expression plasmid

 

pCold I Description

When the temperature of the cultured Escherichia coli was reduced, most of the protein expression was reduced almost temporarily, while a group of proteins called "cold shock protein" was specifically induced. The cold shock expression vector, pCold I-IV, uses the cold shock gene CSPA promoter to design an efficient protein expression vector. The lac operon is inserted at the downstream of CSPA promoter to control expression. In addition, the 5'non translation area (5'UTR), the translation enhancement element (TEE), the His tag sequence, the Xa factor cutting site and the polyclonal site (MCS) are located downstream of the CSPA promoter. Most Escherichia coli strains can be used as the host of the product because of the Escherichia coli promoter. There are four types of pCold vectors, the location of their following parts is slightly different, TEE, His tag sequence and Factor XA enzyme site.

PColdI plasmid is designed by using cold shock gene CSPA promoter to design high efficiency protein expression vector. At the downstream of the promoter, lac operon was inserted to control expression. In addition, the 5 'untranslated region (5' UTR), the translation enhancement element (TEE), the His label sequence, the Xa factor cutting site and the polyclonal site (MCS) are located downstream of the CAPS promoter. When the culture temperature was switched to low temperature, the Escherichia coli stopped growing temporarily and most of the Escherichia coli protein expression decreased, but a class of proteins called cold shock proteins were specifically induced.

 

pCold I Sequence