pCold I Plasmid


  • Model: PVT0601
  • 50 Units in Stock
Ask a question

Add to Cart:

pCold I

Search name

pCold I,Plasmid pCold I,pCold I vector


pCold I Information

Promoter: CspA promoter

Replicator: Ori, F1 ori

Plasmid classification: large intestine plasmid; large intestine expression plasmid; pCold series plasmid.

Plasmid size: 4407bp

Plasmid label: N-His, N-Factor Xa

Prokaryotic resistance: ampicillin Amp (100 u g/ml)

Cloned strains of Escherichia coli, DH5 A and other Escherichia coli

Culture conditions: 37 centigrade, aerobic, LB

Expression of host: BL21 and other Escherichia coli

Culture conditions: 37 centigrade, aerobic, LB

Inducement: IPTG or lactose and its analogues

5'sequencing primers: pCold-F (ACGCCATATCGCCGAAAGG)

3'sequencing primers: pCold-R (GGCAGGGATCTTAGATTCTG)

Remarks: cold start expression plasmid


pCold I Description

When the temperature of the cultured Escherichia coli was reduced, most of the protein expression was reduced almost temporarily, while a group of proteins called "cold shock protein" was specifically induced. The cold shock expression vector, pCold I-IV, uses the cold shock gene CSPA promoter to design an efficient protein expression vector. The lac operon is inserted at the downstream of CSPA promoter to control expression. In addition, the 5'non translation area (5'UTR), the translation enhancement element (TEE), the His tag sequence, the Xa factor cutting site and the polyclonal site (MCS) are located downstream of the CSPA promoter. Most Escherichia coli strains can be used as the host of the product because of the Escherichia coli promoter. There are four types of pCold vectors, the location of their following parts is slightly different, TEE, His tag sequence and Factor XA enzyme site.

PColdI  is designed by using cold shock gene CSPA promoter to design high efficiency protein expression vector. At the downstream of the promoter, lac operon was inserted to control expression. In addition, the 5 'untranslated region (5' UTR), the translation enhancement element (TEE), the His label sequence, the Xa factor cutting site and the polyclonal site (MCS) are located downstream of the CAPS promoter. When the culture temperature was switched to low temperature, the Escherichia coli stopped growing temporarily and most of the Escherichia coli protein expression decreased, but a class of proteins called cold shock proteins were specifically induced.

pCold I vector



pCold I Sequence

LOCUS       Exported                4407 bp ds-DNA     circular SYN 13-SEP-2016
DEFINITION  synthetic circular DNA
KEYWORDS    Untitled 3
SOURCE      synthetic DNA construct
  ORGANISM  synthetic DNA construct
REFERENCE   1  (bases 1 to 4407)
  TITLE     Direct Submission
  JOURNAL   Exported Tuesday, September 13, 2016  
FEATURES             Location/Qualifiers
     source          1..4407
                     /organism="synthetic DNA construct"
                     /mol_type="other DNA"
     protein_bind    84..100
                     /bound_moiety="lac repressor encoded by lacI"
                     /note="lac operator"
                     /note="The lac repressor binds to the lac operator to
                     inhibit transcription in E. coli. This inhibition can be
                     relieved by adding lactose or
                     isopropyl-beta-D-thiogalactopyranoside (IPTG)."
     CDS             271..288
                     /product="6xHis affinity tag"
     CDS             289..300
                     /product="Factor Xa recognition and cleavage site"
                     /note="Factor Xa site"
     rep_origin      complement(711..1166)
                     /note="f1 ori"
                     /note="f1 bacteriophage origin of replication; arrow
                     indicates direction of (+) strand synthesis"
     promoter        1266..1370
                     /note="AmpR promoter"
     CDS             1371..2231
                     /note="confers resistance to ampicillin, carbenicillin, and
                     related antibiotics"
     rep_origin      2402..2990
                     /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of
     CDS             complement(3162..4244)
                     /product="lac repressor"
                     /note="The lac repressor binds to the lac operator to
                     inhibit transcription in E. coli. This inhibition can be
                     relieved by adding lactose or
                     isopropyl-beta-D-thiogalactopyranoside (IPTG)."
     promoter        complement(4245..4322)
                     /note="lacI promoter"
        1 aaggaatggt gtggccgatt aatcataaat atgaaaaata attgttgcat cacccgccaa
       61 tgcgtggctt aatgcacatc aaattgtgag cggataacaa tttgatgtgc tagcgcatat
      121 ccagtgtagt aaggcaagtc ccttcaagag ttatcgttga tacccctcgt agtgcacatt
      181 cctttaacgc ttcaaaatct gtaaagcacg ccatatcgcc gaaaggcaca cttaattatt
      241 aagaggtaat acaccatgaa tcacaaagtg catcatcatc atcatcatat cgaaggtagg
      301 catatggagc tcggtaccct cgagggatcc gaattcaagc ttgtcgacct gcagtctaga
      361 taggtaatct ctgcttaaaa gcacagaatc taagatccct gccatttggc ggggattttt
      421 ttatttgttt tcaggaaata aataatcgat cgcgtaataa aatctattat tatttttgtg
      481 aagaataaat ttgggtgcaa tgagaatgcg caggcccttt cgtctcgcgc gtttcggtga
      541 tgacggtgaa aacctctgac acatgcagct cccggagacg gtcacagctt gtctgtaagc
      601 ggatgccggg agcagacaag cccgtcaggg cgcgtcagcg ggtgttggcg ggtgtcgggg
      661 ctggcttaac tatgcggcat cagagcagat tgtactgaga gtgcaccata aaattgtaaa
      721 cgttaatatt ttgttaaaat tcgcgttaaa tttttgttaa atcagctcat tttttaacca
      781 ataggccgaa atcggcaaaa tcccttataa atcaaaagaa tagcccgaga tagggttgag
      841 tgttgttcca gtttggaaca agagtccact attaaagaac gtggactcca acgtcaaagg
      901 gcgaaaaacc gtctatcagg gcgatggccc actacgtgaa ccatcaccca aatcaagttt
      961 tttggggtcg aggtgccgta aagcactaaa tcggaaccct aaagggagcc cccgatttag
     1021 agcttgacgg ggaaagccgg cgaacgtggc gagaaaggaa gggaagaaag cgaaaggagc
     1081 gggcgctagg gcgctggcaa gtgtagcggt cacgctgcgc gtaaccacca cacccgccgc
     1141 gcttaatgcg ccgctacagg gcgcgtacta tggttgcttt gacgtatgcg gtgtgaaata
     1201 ccgcacagat gcgtaaggag aaaataccgc atcaggcgtc aggtggcact tttcggggaa
     1261 atgtgcgcgg aacccctatt tgtttatttt tctaaataca ttcaaatatg tatccgctca
     1321 tgagacaata accctgataa atgcttcaat aatattgaaa aaggaagagt atgagtattc
     1381 aacatttccg tgtcgccctt attccctttt ttgcggcatt ttgccttcct gtttttgctc

No customer comments for the moment.

Add A Comment

Related Products


No products

Total $0.00

Prices don't include postage.
