pCold III Plasmid


  • Model: PVT0603
  • 50 Units in Stock
Ask a question

Add to Cart:

pCold III

Search name

pCold III,Plasmid pCold III,pCold III vector

pCold III Plasmid informaiton

Promoter: CspA promoter
Replicon: F1 ori, ori
Plasmid classification: large intestine series plasmid; large intestine expression plasmid; pCold series plasmid
Plasmid size: 4377bp
Prokaryotic resistance: ampicillin Amp (100 g/ml)
Clone strain: DH5 alpha and other Escherichia coli
Culture conditions: 37, aerobic, LB
Expression host: BL21 and other Escherichia coli
Culture conditions: 37, aerobic, LB
Induction: IPTG or lactose and its analogues
Primers for 5'sequencing: pCold-F (ACGCCATATCGCCGAAAGG)
Primers for 3'sequencing: pCold-R (GGCAGGGATCTTAGATTCTG)

pCold III Plasmid  Sequence

LOCUS       Exported                4377 bp ds-DNA     circular SYN 13-SEP-2016
DEFINITION  synthetic circular DNA
KEYWORDS    Untitled 6
SOURCE      synthetic DNA construct
  ORGANISM  synthetic DNA construct
REFERENCE   1  (bases 1 to 4377)
  TITLE     Direct Submission
  JOURNAL   Exported Tuesday, September 13, 2016 

FEATURES             Location/Qualifiers
     source          1..4377
                     /organism="synthetic DNA construct"
                     /mol_type="other DNA"
     protein_bind    84..100
                     /bound_moiety="lac repressor encoded by lacI"
                     /note="lac operator"
                     /note="The lac repressor binds to the lac operator to
                     inhibit transcription in E. coli. This inhibition can be
                     relieved by adding lactose or
                     isopropyl-beta-D-thiogalactopyranoside (IPTG)."
     rep_origin      complement(681..1136)
                     /note="f1 ori"
                     /note="f1 bacteriophage origin of replication; arrow
                     indicates direction of (+) strand synthesis"
     promoter        1236..1340
                     /note="AmpR promoter"
     CDS             1341..2201
                     /note="confers resistance to ampicillin, carbenicillin, and
                     related antibiotics"
     rep_origin      2372..2960
                     /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of
     CDS             complement(3132..4214)
                     /product="lac repressor"
                     /note="The lac repressor binds to the lac operator to
                     inhibit transcription in E. coli. This inhibition can be
                     relieved by adding lactose or
                     isopropyl-beta-D-thiogalactopyranoside (IPTG)."
     promoter        complement(4215..4292)
                     /note="lacI promoter"
        1 aaggaatggt gtggccgatt aatcataaat atgaaaaata attgttgcat cacccgccaa
       61 tgcgtggctt aatgcacatc aaattgtgag cggataacaa tttgatgtgc tagcgcatat
      121 ccagtgtagt aaggcaagtc ccttcaagag ttatcgttga tacccctcgt agtgcacatt
      181 cctttaacgc ttcaaaatct gtaaagcacg ccatatcgcc gaaaggcaca cttaattatt
      241 aagaggtaat acaccatgaa tcacaaagtg catatggagc tcggtaccct cgagggatcc
      301 gaattcaagc ttgtcgacct gcagtctaga taggtaatct ctgcttaaaa gcacagaatc
      361 taagatccct gccatttggc ggggattttt ttatttgttt tcaggaaata aataatcgat
      421 cgcgtaataa aatctattat tatttttgtg aagaataaat ttgggtgcaa tgagaatgcg
      481 caggcccttt cgtctcgcgc gtttcggtga tgacggtgaa aacctctgac acatgcagct
      541 cccggagacg gtcacagctt gtctgtaagc ggatgccggg agcagacaag cccgtcaggg
      601 cgcgtcagcg ggtgttggcg ggtgtcgggg ctggcttaac tatgcggcat cagagcagat
      661 tgtactgaga gtgcaccata aaattgtaaa cgttaatatt ttgttaaaat tcgcgttaaa
      721 tttttgttaa atcagctcat tttttaacca ataggccgaa atcggcaaaa tcccttataa
      781 atcaaaagaa tagcccgaga tagggttgag tgttgttcca gtttggaaca agagtccact
      841 attaaagaac gtggactcca acgtcaaagg gcgaaaaacc gtctatcagg gcgatggccc
      901 actacgtgaa ccatcaccca aatcaagttt tttggggtcg aggtgccgta aagcactaaa
      961 tcggaaccct aaagggagcc cccgatttag agcttgacgg ggaaagccgg cgaacgtggc
     1021 gagaaaggaa gggaagaaag cgaaaggagc gggcgctagg gcgctggcaa gtgtagcggt
     1081 cacgctgcgc gtaaccacca cacccgccgc gcttaatgcg ccgctacagg gcgcgtacta
     1141 tggttgcttt gacgtatgcg gtgtgaaata ccgcacagat gcgtaaggag aaaataccgc
     1201 atcaggcgtc aggtggcact tttcggggaa atgtgcgcgg aacccctatt tgtttatttt
     1261 tctaaataca ttcaaatatg tatccgctca tgagacaata accctgataa atgcttcaat
     1321 aatattgaaa aaggaagagt atgagtattc aacatttccg tgtcgccctt attccctttt
     1381 ttgcggcatt ttgccttcct gtttttgctc acccagaaac gctggtgaaa gtaaaagatg
     1441 ctgaagatca gttgggtgca cgagtgggtt acatcgaact ggatctcaac agcggtaaga
     1501 tccttgagag ttttcgcccc gaagaacgtt ttccaatgat gagcactttt aaagttctgc
     1561 tatgtggcgc ggtattatcc cgtattgacg ccgggcaaga gcaactcggt cgccgcatac
     1621 actattctca gaatgacttg gttgagtact caccagtcac agaaaagcat cttacggatg
     1681 gcatgacagt aagagaatta tgcagtgctg ccataaccat gagtgataac actgcggcca
     1741 acttacttct gacaacgatc ggaggaccga aggagctaac cgcttttttg cacaacatgg
     1801 gggatcatgt aactcgcctt gatcgttggg aaccggagct gaatgaagcc ataccaaacg
     1861 acgagcgtga caccacgatg cctgtagcaa tggcaacaac gttgcgcaaa ctattaactg
     1921 gcgaactact tactctagct tcccggcaac aattaataga ctggatggag gcggataaag
     1981 ttgcaggacc acttctgcgc tcggcccttc cggctggctg gtttattgct gataaatctg
     2041 gagccggtga gcgtgggtct cgcggtatca ttgcagcact ggggccagat ggtaagccct
     2101 cccgtatcgt agttatctac acgacgggga gtcaggcaac tatggatgaa cgaaatagac
     2161 agatcgctga gataggtgcc tcactgatta agcattggta actgtcagac caagtttact
     2221 catatatact ttagattgat ttaaaacttc atttttaatt taaaaggatc taggtgaaga
     2281 tcctttttga taatctcatg accaaaatcc cttaacgtga gttttcgttc cactgagcgt
     2341 cagaccccgt agaaaagatc aaaggatctt cttgagatcc tttttttctg cgcgtaatct
     2401 gctgcttgca aacaaaaaaa ccaccgctac cagcggtggt ttgtttgccg gatcaagagc
     2461 taccaactct ttttccgaag gtaactggct tcagcagagc gcagatacca aatactgttc
     2521 ttctagtgta gccgtagtta ggccaccact tcaagaactc tgtagcaccg cctacatacc

No customer comments for the moment.

Add A Comment

Related Products


No products

Total $0.00

Prices don't include postage.
