pCold- SUMO


  • Model: PVT0606
  • 50 Units in Stock
Ask a question

Add to Cart:


PVT0606     2ug


pCold-SUMO Information

Promoter: CspA promoter

Replicator: ColE1 ori, F1 ori

Plasmid classification: large intestine plasmid, large intestine expression plasmid, pCold plasmid.

Plasmid size: 4740bp

Plasmid label: N-His, N-SUMO

Prokaryotic resistance: ampicillin Amp (100 u g/ml)

Cloned strains of Escherichia coli, DH5 A and other Escherichia coli

Culture conditions: 37 centigrade, aerobic, LB

Expression of host: BL21 and other Escherichia coli

Culture conditions: 37 centigrade, aerobic, LB

Inducement: IPTG or lactose and its analogues

5'sequencing primers: pCold-F (ACGCCATATCGCCGAAAGG)

3'sequencing primers: pCold-R (GGCAGGGATCTTAGATTCTG)

Remarks: cold shock expression vector


pCold-SUMO Description

A prokaryotic expression vector (pCold-SUMO) is reformed on the basis of pCold carrier, and the carrier promoter (CS Promoter) is derived from Antarctic eosinophilic bacteria. The protein expression can be activated at low temperature (15 degrees). At low temperature, bacteria grow slowly, which slows the protein synthesis speed, thus maximizing the probability of the correct folding of the protein, improving the protein soluble expression and enhancing the expression ratio of the active protein. The expression of SUMO tag contained in the expression system can greatly improve the expression of small molecular weight protein, and further improve the soluble expression probability of protein. Meanwhile, the kit SUMO Protease (containing 6 x His tag) can specifically remove SUMO tag, so as to get recombinant protein without any label. TEE signal peptide can enhance the high expression of target protein under the regulation of cold promoter. BL21 (DE3) Chaprone E.coli bacteria contain molecular chaperones, and their expression products can assist in the correct folding of recombinant proteins to form soluble active proteins. The molecular chaperone protein granule is chloramphenicol resistant (chloramphenicol, Cmr), and its expression is controlled by tetracycline (tetR) operon.

PCold-SUMO plasmid is designed by using the cold shock gene CSPA promoter to design high efficiency protein expression vector. At the downstream of E.COLI promoter, lac operon was inserted to control expression. In addition, the 5 'untranslated region (5' UTR), the translation enhancement element (TEE), the His label sequence, the Xa factor cutting site and the polyclonal site (MCS) are located downstream of the CAPS promoter. When the culture temperature was switched to low temperature, the Escherichia coli stopped growing temporarily and most of the Escherichia coli protein expression decreased, but a class of proteins called cold shock proteins were specifically induced.



pCold-SUMO Sequence

LOCUS       Exported                4740 bp ds-DNA     circular SYN 22-JUN-2017
DEFINITION  synthetic circular DNA
SOURCE      synthetic DNA construct
  ORGANISM  synthetic DNA construct
REFERENCE   1  (bases 1 to 4740)
  TITLE     Direct Submission
  JOURNAL   Exported Thursday, June 22, 2017 
FEATURES             Location/Qualifiers
     source          1..4740
                     /organism="synthetic DNA construct"
                     /mol_type="other DNA"
     misc_feature    15..81
                     /note="cspA promoter"
     misc_feature    82..121
                     /note="lac operator"
     protein_bind    84..100
                     /bound_moiety="lac repressor encoded by lacI"
                     /note="lac operator"
                     /note="The lac repressor binds to the lac operator to
                     inhibit transcription in E. coli. This inhibition can be
                     relieved by adding lactose or
                     isopropyl-beta-D-thiogalactopyranoside (IPTG)."
     misc_feature    122..255
                     /note="cspA 5'UTR"
     misc_feature    243..246
     misc_feature    256..270
     CDS             271..288
                     /product="6xHis affinity tag"
     CDS             289..300
                     /product="Factor Xa recognition and cleavage site"
                     /note="Factor Xa site"
     CDS             340..633
                     /gene="S. cerevisiae SMT3 (truncated)"
                     /product="cleavable ubiquitin-like protein tag"
     misc_feature    634..693
     misc_feature    701..845
                     /note="cspA 3'UTR"
     misc_feature    729..746
                     /note="transcription terminator"
     rep_origin      complement(1044..1499)
                     /note="f1 ori"
                     /note="f1 bacteriophage origin of replication; arrow
                     indicates direction of (+) strand synthesis"
     promoter        1599..1703
                     /note="AmpR promoter"
     CDS             1704..2564
                     /note="confers resistance to ampicillin, carbenicillin, and
                     related antibiotics"
     rep_origin      2735..3323
                     /note="ColE1 ori"
                     /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of
     CDS             complement(3495..4577)
                     /product="lac repressor"
                     /note="The lac repressor binds to the lac operator to
                     inhibit transcription in E. coli. This inhibition can be
                     relieved by adding lactose or
                     isopropyl-beta-D-thiogalactopyranoside (IPTG)."
     promoter        complement(4578..4655)
                     /note="lacI promoter"
        1 aaggaatggt gtggccgatt aatcataaat atgaaaaata attgttgcat cacccgccaa
       61 tgcgtggctt aatgcacatc aaattgtgag cggataacaa tttgatgtgc tagcgcatat
      121 ccagtgtagt aaggcaagtc ccttcaagag ttatcgttga tacccctcgt agtgcacatt
      181 cctttaacgc ttcaaaatct gtaaagcacg ccatatcgcc gaaaggcaca cttaattatt
      241 aagaggtaat acaccatgaa tcacaaagtg catcatcatc atcatcatat cgaaggtagg
      301 catatgggcg gtggcggtag cggcggtggc ggtagcggta tgtcggactc agaagtcaat
      361 caagaagcta agccagaggt caagccagaa gtcaagcctg agactcacat caatttaaag
      421 gtgtccgatg gatcttcaga gatcttcttc aagatcaaaa agaccactcc tttaagaagg
      481 ctgatggaag cgttcgctaa aagacagggt aaggaaatgg actccttaag attcttgtac
      541 gacggtatta gaattcaagc tgatcagacc cctgaagatt tggacatgga ggataacgat
      601 attattgagg ctcacagaga acagattggt ggtactagtg agctcggtac cctcgaggga
      661 tccgaattca agcttgtcga cctgcagtct agataggtaa tctctgctta aaagcacaga
      721 atctaagatc cctgccattt ggcggggatt tttttatttg ttttcaggaa ataaataatc
      781 gatcgcgtaa taaaatctat tattattttt gtgaagaata aatttgggtg caatgagaat
      841 gcgcaggccc tttcgtctcg cgcgtttcgg tgatgacggt gaaaacctct gacacatgca
      901 gctcccggag acggtcacag cttgtctgta agcggatgcc gggagcagac aagcccgtca
      961 gggcgcgtca gcgggtgttg gcgggtgtcg gggctggctt aactatgcgg catcagagca
     1021 gattgtactg agagtgcacc ataaaattgt aaacgttaat attttgttaa aattcgcgtt
     1081 aaatttttgt taaatcagct cattttttaa ccaataggcc gaaatcggca aaatccctta
     1141 taaatcaaaa gaatagcccg agatagggtt gagtgttgtt ccagtttgga acaagagtcc
     1201 actattaaag aacgtggact ccaacgtcaa agggcgaaaa accgtctatc agggcgatgg
     1261 cccactacgt gaaccatcac ccaaatcaag ttttttgggg tcgaggtgcc gtaaagcact
     1321 aaatcggaac cctaaaggga gcccccgatt tagagcttga cggggaaagc cggcgaacgt
     1381 ggcgagaaag gaagggaaga aagcgaaagg agcgggcgct agggcgctgg caagtgtagc
     1441 ggtcacgctg cgcgtaacca ccacacccgc cgcgcttaat gcgccgctac agggcgcgta
     1501 ctatggttgc tttgacgtat gcggtgtgaa ataccgcaca gatgcgtaag gagaaaatac
     1561 cgcatcaggc gtcaggtggc acttttcggg gaaatgtgcg cggaacccct atttgtttat
     1621 ttttctaaat acattcaaat atgtatccgc tcatgagaca ataaccctga taaatgcttc
     1681 aataatattg aaaaaggaag agtatgagta ttcaacattt ccgtgtcgcc cttattccct
     1741 tttttgcggc attttgcctt cctgtttttg ctcacccaga aacgctggtg aaagtaaaag
     1801 atgctgaaga tcagttgggt gcacgagtgg gttacatcga actggatctc aacagcggta
     1861 agatccttga gagttttcgc cccgaagaac gttttccaat gatgagcact tttaaagttc
     1921 tgctatgtgg cgcggtatta tcccgtattg acgccgggca agagcaactc ggtcgccgca
     1981 tacactattc tcagaatgac ttggttgagt actcaccagt cacagaaaag catcttacgg
     2041 atggcatgac agtaagagaa ttatgcagtg ctgccataac catgagtgat aacactgcgg
     2101 ccaacttact tctgacaacg atcggaggac cgaaggagct aaccgctttt ttgcacaaca
     2161 tgggggatca tgtaactcgc cttgatcgtt gggaaccgga gctgaatgaa gccataccaa
     2221 acgacgagcg tgacaccacg atgcctgtag caatggcaac aacgttgcgc aaactattaa
     2281 ctggcgaact acttactcta gcttcccggc aacaattaat agactggatg gaggcggata
     2341 aagttgcagg accacttctg cgctcggccc ttccggctgg ctggtttatt gctgataaat
     2401 ctggagccgg tgagcgtggg tctcgcggta tcattgcagc actggggcca gatggtaagc
     2461 cctcccgtat cgtagttatc tacacgacgg ggagtcaggc aactatggat gaacgaaata
     2521 gacagatcgc tgagataggt gcctcactga ttaagcattg gtaactgtca gaccaagttt
     2581 actcatatat actttagatt gatttaaaac ttcattttta atttaaaagg atctaggtga
     2641 agatcctttt tgataatctc atgaccaaaa tcccttaacg tgagttttcg ttccactgag
     2701 cgtcagaccc cgtagaaaag atcaaaggat cttcttgaga tccttttttt ctgcgcgtaa
     2761 tctgctgctt gcaaacaaaa aaaccaccgc taccagcggt ggtttgtttg ccggatcaag
     2821 agctaccaac tctttttccg aaggtaactg gcttcagcag agcgcagata ccaaatactg
     2881 ttcttctagt gtagccgtag ttaggccacc acttcaagaa ctctgtagca ccgcctacat
     2941 acctcgctct gctaatcctg ttaccagtgg ctgctgccag tggcgataag tcgtgtctta
     3001 ccgggttgga ctcaagacga tagttaccgg ataaggcgca gcggtcgggc tgaacggggg
     3061 gttcgtgcac acagcccagc ttggagcgaa cgacctacac cgaactgaga tacctacagc
     3121 gtgagctatg agaaagcgcc acgcttcccg aagggagaaa ggcggacagg tatccggtaa
     3181 gcggcagggt cggaacagga gagcgcacga gggagcttcc agggggaaac gcctggtatc
     3241 tttatagtcc tgtcgggttt cgccacctct gacttgagcg tcgatttttg tgatgctcgt
     3301 caggggggcg gagcctatgg aaaaacgcca gcaacgcggc ctttttacgg ttcctggcct
     3361 tttgctggcc ttttgctcac atagtcatgc cccgcgccca ccggaaggag ctgactgggt
     3421 tgaaggctct caagggcatc ggtcgagatc ccggtgccta atgagtgagc taacttacat
     3481 taattgcgtt gcgctcactg cccgctttcc agtcgggaaa cctgtcgtgc cagctgcatt
     3541 aatgaatcgg ccaacgcgcg gggagaggcg gtttgcgtat tgggcgccag ggtggttttt
     3601 cttttcacca gtgagacggg caacagctga ttgcccttca ccgcctggcc ctgagagagt
     3661 tgcagcaagc ggtccacgct ggtttgcccc agcaggcgaa aatcctgttt gatggtggtt
     3721 aacggcggga tataacatga gctgtcttcg gtatcgtcgt atcccactac cgagatatcc
     3781 gcaccaacgc gcagcccgga ctcggtaatg gcgcgcattg cgcccagcgc catctgatcg
     3841 ttggcaacca gcatcgcagt gggaacgatg ccctcattca gcatttgcat ggtttgttga
     3901 aaaccggaca tggcactcca gtcgccttcc cgttccgcta tcggctgaat ttgattgcga
     3961 gtgagatatt tatgccagcc agccagacgc agacgcgccg agacagaact taatgggccc
     4021 gctaacagcg cgatttgctg gtgacccaat gcgaccagat gctccacgcc cagtcgcgta
     4081 ccgtcttcat gggagaaaat aatactgttg atgggtgtct ggtcagagac atcaagaaat
     4141 aacgccggaa cattagtgca ggcagcttcc acagcaatgg catcctggtc atccagcgga
     4201 tagttaatga tcagcccact gacgcgttgc gcgagaagat tgtgcaccgc cgctttacag
     4261 gcttcgacgc cgcttcgttc taccatcgac accaccacgc tggcacccag ttgatcggcg
     4321 cgagatttaa tcgccgcgac aatttgcgac ggcgcgtgca gggccagact ggaggtggca
     4381 acgccaatca gcaacgactg tttgcccgcc agttgttgtg ccacgcggtt gggaatgtaa
     4441 ttcagctccg ccatcgccgc ttccactttt tcccgcgttt tcgcagaaac gtggctggcc
     4501 tggttcacca cgcgggaaac ggtctgataa gagacaccgg catactctgc gacatcgtat
     4561 aacgttactg gtttcacatt caccaccctg aattgactct cttccgggcg ctatcatgcc
     4621 ataccgcgaa aggttttgcg ccattcgatg gtgtccggga tctcgacgct ctcccttatg
     4681 cgactcctgc attaggaagc agcccagtag taggttgagg ccgttgagca ccgccgccgc

Product is for research use only!

Search name

pCold-SUMO,Plasmid pCold-SUMO,pCold-SUMO vector

No customer comments for the moment.

Add A Comment

Related Products


No products

Total $0.00

Prices don't include postage.
