pCold- SUMO Plasmid


  • Model: PVT0606
  • 50 Units in Stock
Ask a question

Add to Cart:


Search name

pCold-SUMO,Plasmid pCold-SUMO,pCold-SUMO vector


pCold-SUMO Information

Promoter: CspA promoter

Replicator: ColE1 ori, F1 ori

Plasmid classification: large intestine plasmid, large intestine expression plasmid, pCold plasmid.

Plasmid size: 4740bp

Plasmid label: N-His, N-SUMO

Prokaryotic resistance: ampicillin Amp (100 u g/ml)

Cloned strains of Escherichia coli, DH5 A and other Escherichia coli

Culture conditions: 37 centigrade, aerobic, LB

Expression of host: BL21 and other Escherichia coli

Culture conditions: 37 centigrade, aerobic, LB

Inducement: IPTG or lactose and its analogues

5'sequencing primers: pCold-F (ACGCCATATCGCCGAAAGG)

3'sequencing primers: pCold-R (GGCAGGGATCTTAGATTCTG)

Remarks: cold shock expression vector


pCold-SUMO Description

A prokaryotic expression vector (pCold-SUMO) is reformed on the basis of pCold carrier, and the carrier promoter (CS Promoter) is derived from Antarctic eosinophilic bacteria. The protein expression can be activated at low temperature (15 degrees). At low temperature, bacteria grow slowly, which slows the protein synthesis speed, thus maximizing the probability of the correct folding of the protein, improving the protein soluble expression and enhancing the expression ratio of the active protein. The expression of SUMO tag contained in the expression system can greatly improve the expression of small molecular weight protein, and further improve the soluble expression probability of protein. Meanwhile, the kit SUMO Protease (containing 6 x His tag) can specifically remove SUMO tag, so as to get recombinant protein without any label. TEE signal peptide can enhance the high expression of target protein under the regulation of cold promoter. BL21 (DE3) Chaprone E.coli bacteria contain molecular chaperones, and their expression products can assist in the correct folding of recombinant proteins to form soluble active proteins. The molecular chaperone protein granule is chloramphenicol resistant (chloramphenicol, Cmr), and its expression is controlled by tetracycline (tetR) operon.

PCold-SUMO plasmid is designed by using the cold shock gene CSPA promoter to design high efficiency protein expression vector. At the downstream of E.COLI promoter, lac operon was inserted to control expression. In addition, the 5 'untranslated region (5' UTR), the translation enhancement element (TEE), the His label sequence, the Xa factor cutting site and the polyclonal site (MCS) are located downstream of the CAPS promoter. When the culture temperature was switched to low temperature, the Escherichia coli stopped growing temporarily and most of the Escherichia coli protein expression decreased, but a class of proteins called cold shock proteins were specifically induced.



pCold-SUMO Sequence

LOCUS       Exported                4740 bp ds-DNA     circular SYN 22-JUN-2017
DEFINITION  synthetic circular DNA
SOURCE      synthetic DNA construct
  ORGANISM  synthetic DNA construct
REFERENCE   1  (bases 1 to 4740)
  TITLE     Direct Submission
  JOURNAL   Exported Thursday, June 22, 2017  
FEATURES             Location/Qualifiers
     source          1..4740
                     /organism="synthetic DNA construct"
                     /mol_type="other DNA"
     misc_feature    15..81
                     /note="cspA promoter"
     misc_feature    82..121
                     /note="lac operator"
     protein_bind    84..100
                     /bound_moiety="lac repressor encoded by lacI"
                     /note="lac operator"
                     /note="The lac repressor binds to the lac operator to
                     inhibit transcription in E. coli. This inhibition can be
                     relieved by adding lactose or
                     isopropyl-beta-D-thiogalactopyranoside (IPTG)."
     misc_feature    122..255
                     /note="cspA 5'UTR"
     misc_feature    243..246
     misc_feature    256..270
     CDS             271..288
                     /product="6xHis affinity tag"
     CDS             289..300
                     /product="Factor Xa recognition and cleavage site"
                     /note="Factor Xa site"
     CDS             340..633
                     /gene="S. cerevisiae SMT3 (truncated)"
                     /product="cleavable ubiquitin-like protein tag"
     misc_feature    634..693
     misc_feature    701..845
                     /note="cspA 3'UTR"
     misc_feature    729..746
                     /note="transcription terminator"
     rep_origin      complement(1044..1499)
                     /note="f1 ori"
                     /note="f1 bacteriophage origin of replication; arrow
                     indicates direction of (+) strand synthesis"
     promoter        1599..1703
                     /note="AmpR promoter"
     CDS             1704..2564
                     /note="confers resistance to ampicillin, carbenicillin, and
                     related antibiotics"
     rep_origin      2735..3323
                     /note="ColE1 ori"
                     /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of
     CDS             complement(3495..4577)
                     /product="lac repressor"
                     /note="The lac repressor binds to the lac operator to
                     inhibit transcription in E. coli. This inhibition can be
                     relieved by adding lactose or
                     isopropyl-beta-D-thiogalactopyranoside (IPTG)."
     promoter        complement(4578..4655)

No customer comments for the moment.

Add A Comment

Related Products


No products

Total $0.00

Prices don't include postage.
