pCold TF


  • Model: PVT0605
  • 48 Units in Stock
Ask a question

Add to Cart:

pCold TF

PVT0605      2ug


pCold TF Information

Promoter: CspA promoter
Replicator: ColE1 ori, F1 ori
Plasmid classification: Escherichia coli plasmids; large intestine expression plasmids; pCold series plasmids
Plasmid size: 5769bp
Plasmid Tags: N-His, N-Trigger factor, N-HRV 3C, N-Thrombin, N-Factor Xa
Prokaryotic resistance: ampicillin Amp (100 u g/ml)
Cloned strains of Escherichia coli, DH5 A and other Escherichia coli
Culture conditions: 37 centigrade, aerobic, LB
Expression of host: BL21 and other Escherichia coli
Culture conditions: 37 centigrade, aerobic, LB
Inducement: IPTG or lactose and its analogues
5'sequencing primers: pCold-TF-F1 (CCACTTTCAACGAGCTGATG)
3'sequencing primers: pCold-R (GGCAGGGATCTTAGATTCTG)
Remarks: cold start expression plasmid


pCold TF Description

pCold TF vector is a cold shock carrier that combines the soluble label "Trigger Factor (TF) companion". The "trigger factor" (48KD) is a prokaryotic ribosome related molecular chaperone protein (48 kDa), which is beneficial to the co translational folding of the newly expressed peptides. It is because it is derived from Escherichia coli that the trigger factor can be highly expressed in the Escherichia coli expression system. PCold TF vector is composed of CSPA promoter and its downstream sequence. Its downstream sequence mainly includes 5'untranslated region (5' non coding region), translation enhancer element (TEE), His tag sequence and polyclonal site (MCS). The Lac operon is inserted in the downstream of the CSPA promoter to ensure strict regulation of expression. In addition, HRV 3C protease, thrombin and Factor Xa recognition sites were located between Trigger Factor and polyclonal sites (MCS), so that labels could be removed for fusion proteins expressed. Most Escherichia coli strains can be used as the host for the expression of this vector. PCold TF vector provides a cold shock inducing method to express target protein at high level, plus the expression of triggering factor (partner) to improve the correct protein folding, so as to achieve efficient and soluble expression of other proteins in other systems.
The pColdTF plasmid is an efficient protein expression vector designed by using the cold shock gene CSPA promoter. At the lower reaches of the E.COLI promoter, the lac operon is inserted to strictly control the expression. In addition, the 5 'untranslated region (5' UTR), the translation enhancer element (TEE), the His tag sequence, the Xa factor cleavage site and the polyclonal site (MCS) are located downstream of the CAPS promoter. When the culture temperature was switched to low temperature, the growth of Escherichia coli stopped temporarily, and the protein expression of most Escherichia coli decreased. However, a group of proteins called cold shock protein were specifically induced to express.




pCold TF Sequence

LOCUS       Exported                5769 bp ds-DNA     circular SYN 13-SEP-2016
DEFINITION  synthetic circular DNA
KEYWORDS    Untitled 9
SOURCE      synthetic DNA construct
  ORGANISM  synthetic DNA construct
REFERENCE   1  (bases 1 to 5769)
  TITLE     Direct Submission
  JOURNAL   Exported Tuesday, September 13, 2016 
FEATURES             Location/Qualifiers
     source          1..5769
                     /organism="synthetic DNA construct"
                     /mol_type="other DNA"
     protein_bind    84..100
                     /bound_moiety="lac repressor encoded by lacI"
                     /note="lac operator"
                     /note="The lac repressor binds to the lac operator to
                     inhibit transcription in E. coli. This inhibition can be
                     relieved by adding lactose or
                     isopropyl-beta-D-thiogalactopyranoside (IPTG)."
     CDS             271..288
                     /product="6xHis affinity tag"
     CDS             1594..1617
                     /product="recognition and cleavage site for human
                     rhinovirus 3C and PreScission proteases"
                     /note="HRV 3C site"
     CDS             1627..1644
                     /product="thrombin recognition and cleavage site"
                     /note="thrombin site"
     CDS             1651..1662
                     /product="Factor Xa recognition and cleavage site"
                     /note="Factor Xa site"
     rep_origin      complement(2073..2528)
                     /note="f1 ori"
                     /note="f1 bacteriophage origin of replication; arrow
                     indicates direction of (+) strand synthesis"
     promoter        2628..2732
                     /note="AmpR promoter"
     CDS             2733..3593
                     /note="confers resistance to ampicillin, carbenicillin, and
                     related antibiotics"
     rep_origin      3764..4352
                     /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of
     CDS             complement(4524..5606)
                     /product="lac repressor"
                     /note="The lac repressor binds to the lac operator to
                     inhibit transcription in E. coli. This inhibition can be
                     relieved by adding lactose or
                     isopropyl-beta-D-thiogalactopyranoside (IPTG)."
     promoter        complement(5607..5684)
                     /note="lacI promoter"
        1 aaggaatggt gtggccgatt aatcataaat atgaaaaata attgttgcat cacccgccaa
       61 tgcgtggctt aatgcacatc aaattgtgag cggataacaa tttgatgtgc tagcgcatat
      121 ccagtgtagt aaggcaagtc ccttcaagag ttatcgttga tacccctcgt agtgcacatt
      181 cctttaacgc ttcaaaatct gtaaagcacg ccatatcgcc gaaaggcaca cttaattatt
      241 aagaggtaat acaccatgaa tcacaaagtg catcatcatc atcatcacat gcaagtttca
      301 gttgaaacca ctcaaggcct tggccgccgt gtaacgatta ctatcgctgc tgacagcatc
      361 gagaccgctg ttaaaagcga gctggtcaac gttgcgaaaa aagtacgtat tgacggcttc
      421 cgcaagggca aagtgccaat gaatatcgtt gctcagcgtt atggcgcgtc tgtacgccag
      481 gacgttctgg gtgacctgat gagccgtaac ttcattgacg ccatcattaa agaaaaaatc
      541 aatccggctg gcgcaccgac ttatgttccg ggcgaataca agctgggtga agacttcact
      601 tactctgtag agtttgaagt ttatccggaa gttgaactgc aaggtctgga agcgatcgaa
      661 gttgaaaaac cgatcgttga agtgaccgac gctgacgttg acggcatgct ggatactctg
      721 cgtaaacagc aggcgacctg gaaagaaaaa gacggcgctg ttgaagcaga agaccgcgtg
      781 accatcgact tcaccggttc tgtagacggc gaagagttcg aaggcggtaa agcgtctgat
      841 ttcgtactgg cgatgggcca gggtcgtatg atcccgggct ttgaagacgg tatcaaaggc
      901 cacaaagctg gcgaagagtt caccatcgac gtgaccttcc cggaagaata ccacgcagaa
      961 aacctgaaag gtaaagcagc gaaattcgct atcaacctga agaaagttga agagcgtgaa
     1021 ctgccggaac tgaccgcaga gttcatcaaa cgtttcggcg ttgaagatgg ttccgtagaa
     1081 ggtctgcgcg ctgaagtgcg taaaaacatg gagcgcgagc tgaagagcgc catccgtaac
     1141 cgcgttaagt ctcaggcgat cgaaggtctg gtaaaagcta acgacatcga cgtaccggct
     1201 gcgctgatcg acagcgaaat cgacgttctg cgtcgccagg ctgcacagcg tttcggtggc
     1261 aacgaaaaac aagctctgga actgccgcgc gaactgttcg aagaacaggc taaacgccgc
     1321 gtagttgttg gcctgctgct gggcgaagtt atccgcacca acgagctgaa agctgacgaa
     1381 gagcgcgtga aaggcctgat cgaagagatg gcttctgcgt acgaagatcc gaaagaagtt
     1441 atcgagttct acagcaaaaa caaagaactg atggacaaca tgcgcaatgt tgctctggaa
     1501 gaacaggctg ttgaagctgt actggcgaaa gcgaaagtga ctgaaaaaga aaccactttc
     1561 aacgagctga tgaaccagca ggcgtccgcg ggtctggaag ttctgttcca ggggccctcc
     1621 gcgggtctgg tgccacgcgg tagtggtggt atcgaaggta ggcatatgga gctcggtacc
     1681 ctcgagggat ccgaattcaa gcttgtcgac ctgcagtcta gataggtaat ctctgcttaa
     1741 aagcacagaa tctaagatcc ctgccatttg gcggggattt ttttatttgt tttcaggaaa
     1801 taaataatcg atcgcgtaat aaaatctatt attatttttg tgaagaataa atttgggtgc
     1861 aatgagaatg cgcaggccct ttcgtctcgc gcgtttcggt gatgacggtg aaaacctctg
     1921 acacatgcag ctcccggaga cggtcacagc ttgtctgtaa gcggatgccg ggagcagaca
     1981 agcccgtcag ggcgcgtcag cgggtgttgg cgggtgtcgg ggctggctta actatgcggc
     2041 atcagagcag attgtactga gagtgcacca taaaattgta aacgttaata ttttgttaaa
     2101 attcgcgtta aatttttgtt aaatcagctc attttttaac caataggccg aaatcggcaa
     2161 aatcccttat aaatcaaaag aatagcccga gatagggttg agtgttgttc cagtttggaa
     2221 caagagtcca ctattaaaga acgtggactc caacgtcaaa gggcgaaaaa ccgtctatca
     2281 gggcgatggc ccactacgtg aaccatcacc caaatcaagt tttttggggt cgaggtgccg
     2341 taaagcacta aatcggaacc ctaaagggag cccccgattt agagcttgac ggggaaagcc
     2401 ggcgaacgtg gcgagaaagg aagggaagaa agcgaaagga gcgggcgcta gggcgctggc
     2461 aagtgtagcg gtcacgctgc gcgtaaccac cacacccgcc gcgcttaatg cgccgctaca
     2521 gggcgcgtac tatggttgct ttgacgtatg cggtgtgaaa taccgcacag atgcgtaagg
     2581 agaaaatacc gcatcaggcg tcaggtggca cttttcgggg aaatgtgcgc ggaaccccta
     2641 tttgtttatt tttctaaata cattcaaata tgtatccgct catgagacaa taaccctgat
     2701 aaatgcttca ataatattga aaaaggaaga gtatgagtat tcaacatttc cgtgtcgccc
     2761 ttattccctt ttttgcggca ttttgccttc ctgtttttgc tcacccagaa acgctggtga
     2821 aagtaaaaga tgctgaagat cagttgggtg cacgagtggg ttacatcgaa ctggatctca
     2881 acagcggtaa gatccttgag agttttcgcc ccgaagaacg ttttccaatg atgagcactt
     2941 ttaaagttct gctatgtggc gcggtattat cccgtattga cgccgggcaa gagcaactcg
     3001 gtcgccgcat acactattct cagaatgact tggttgagta ctcaccagtc acagaaaagc
     3061 atcttacgga tggcatgaca gtaagagaat tatgcagtgc tgccataacc atgagtgata
     3121 acactgcggc caacttactt ctgacaacga tcggaggacc gaaggagcta accgcttttt
     3181 tgcacaacat gggggatcat gtaactcgcc ttgatcgttg ggaaccggag ctgaatgaag
     3241 ccataccaaa cgacgagcgt gacaccacga tgcctgtagc aatggcaaca acgttgcgca
     3301 aactattaac tggcgaacta cttactctag cttcccggca acaattaata gactggatgg
     3361 aggcggataa agttgcagga ccacttctgc gctcggccct tccggctggc tggtttattg
     3421 ctgataaatc tggagccggt gagcgtgggt ctcgcggtat cattgcagca ctggggccag
     3481 atggtaagcc ctcccgtatc gtagttatct acacgacggg gagtcaggca actatggatg
     3541 aacgaaatag acagatcgct gagataggtg cctcactgat taagcattgg taactgtcag
     3601 accaagttta ctcatatata ctttagattg atttaaaact tcatttttaa tttaaaagga
     3661 tctaggtgaa gatccttttt gataatctca tgaccaaaat cccttaacgt gagttttcgt
     3721 tccactgagc gtcagacccc gtagaaaaga tcaaaggatc ttcttgagat cctttttttc
     3781 tgcgcgtaat ctgctgcttg caaacaaaaa aaccaccgct accagcggtg gtttgtttgc
     3841 cggatcaaga gctaccaact ctttttccga aggtaactgg cttcagcaga gcgcagatac
     3901 caaatactgt tcttctagtg tagccgtagt taggccacca cttcaagaac tctgtagcac
     3961 cgcctacata cctcgctctg ctaatcctgt taccagtggc tgctgccagt ggcgataagt
     4021 cgtgtcttac cgggttggac tcaagacgat agttaccgga taaggcgcag cggtcgggct
     4081 gaacgggggg ttcgtgcaca cagcccagct tggagcgaac gacctacacc gaactgagat
     4141 acctacagcg tgagctatga gaaagcgcca cgcttcccga agggagaaag gcggacaggt
     4201 atccggtaag cggcagggtc ggaacaggag agcgcacgag ggagcttcca gggggaaacg
     4261 cctggtatct ttatagtcct gtcgggtttc gccacctctg acttgagcgt cgatttttgt
     4321 gatgctcgtc aggggggcgg agcctatgga aaaacgccag caacgcggcc tttttacggt
     4381 tcctggcctt ttgctggcct tttgctcaca tagtcatgcc ccgcgcccac cggaaggagc
     4441 tgactgggtt gaaggctctc aagggcatcg gtcgagatcc cggtgcctaa tgagtgagct
     4501 aacttacatt aattgcgttg cgctcactgc ccgctttcca gtcgggaaac ctgtcgtgcc
     4561 agctgcatta atgaatcggc caacgcgcgg ggagaggcgg tttgcgtatt gggcgccagg
     4621 gtggtttttc ttttcaccag tgagacgggc aacagctgat tgcccttcac cgcctggccc
     4681 tgagagagtt gcagcaagcg gtccacgctg gtttgcccca gcaggcgaaa atcctgtttg
     4741 atggtggtta acggcgggat ataacatgag ctgtcttcgg tatcgtcgta tcccactacc
     4801 gagatatccg caccaacgcg cagcccggac tcggtaatgg cgcgcattgc gcccagcgcc
     4861 atctgatcgt tggcaaccag catcgcagtg ggaacgatgc cctcattcag catttgcatg
     4921 gtttgttgaa aaccggacat ggcactccag tcgccttccc gttccgctat cggctgaatt
     4981 tgattgcgag tgagatattt atgccagcca gccagacgca gacgcgccga gacagaactt
     5041 aatgggcccg ctaacagcgc gatttgctgg tgacccaatg cgaccagatg ctccacgccc
     5101 agtcgcgtac cgtcttcatg ggagaaaata atactgttga tgggtgtctg gtcagagaca
     5161 tcaagaaata acgccggaac attagtgcag gcagcttcca cagcaatggc atcctggtca
     5221 tccagcggat agttaatgat cagcccactg acgcgttgcg cgagaagatt gtgcaccgcc
     5281 gctttacagg cttcgacgcc gcttcgttct accatcgaca ccaccacgct ggcacccagt
     5341 tgatcggcgc gagatttaat cgccgcgaca atttgcgacg gcgcgtgcag ggccagactg
     5401 gaggtggcaa cgccaatcag caacgactgt ttgcccgcca gttgttgtgc cacgcggttg
     5461 ggaatgtaat tcagctccgc catcgccgct tccacttttt cccgcgtttt cgcagaaacg
     5521 tggctggcct ggttcaccac gcgggaaacg gtctgataag agacaccggc atactctgcg
     5581 acatcgtata acgttactgg tttcacattc accaccctga attgactctc ttccgggcgc
     5641 tatcatgcca taccgcgaaa ggttttgcgc cattcgatgg tgtccgggat ctcgacgctc
     5701 tcccttatgc gactcctgca ttaggaagca gcccagtagt aggttgaggc cgttgagcac
     5761 cgccgccgc


Product is for research use only!


Search name

pCold TF,Plasmid pCold TF,pCold TF vector

No customer comments for the moment.

Add A Comment

Related Products


No products

Total $0.00

Prices don't include postage.
