pCP20 Plasmid


  • Model: PVT6006
  • 50 Units in Stock
Ask a question

Add to Cart:


PVT6006   100ul

Search name

pCP20,Plasmid pCP20,pCP20 vector

pCP20 Plasmid information

Replicon: pSC101 ori
Plasmid classification: large intestine series plasmid; large intestine editing plasmid; large intestine Red plasmid
Plasmid size: 9332bp
Clone strain: DH5 alpha and other Escherichia coli
Culture conditions: 30, LB, aerobic
Primers for 5'sequencing: FLP-R (GAGCTTTGTTGTAGGTGGACC)
Primers for 3'sequencing: FLP-F (TTGATGCGCTGGCAGTGTTC)
Use:Homologous recombination HR plasmid

pCP20 plasmid

pCP20 Plasmid Sequence

LOCUS       Exported                9332 bp ds-DNA     circular SYN 27-JUN-2017
DEFINITION  synthetic circular DNA
SOURCE      synthetic DNA construct
  ORGANISM  synthetic DNA construct
REFERENCE   1  (bases 1 to 9332)
  TITLE     Direct Submission
  JOURNAL   Exported Tuesday, June 27, 2017
FEATURES             Location/Qualifiers
     source          1..9332
                     /organism="synthetic DNA construct"
                     /mol_type="other DNA"
     CDS             complement(561..1220)
                     /product="chloramphenicol acetyltransferase"
                     /note="confers resistance to chloramphenicol"
     promoter        complement(1221..1323)
                     /note="cat promoter"
                     /note="promoter of the E. coli cat gene encoding
                     chloramphenicol acetyltransferase"
     rep_origin      1875..2097
                     /note="pSC101 ori"
                     /note="low-copy replication origin that requires the Rep101
     CDS             2145..3095
                     /gene="rep101 encoding an A56V mutation"
                     /product="temperature-sensitive version of a protein needed
                     for replication with the pSC101 origin"
     CDS             complement(4557..5417)
                     /note="confers resistance to ampicillin, carbenicillin, and
                     related antibiotics"
     promoter        complement(5418..5522)
                     /note="AmpR promoter"
     CDS             complement(6556..7827)
                     /product="site-specific recombinase"
                     /note="FLP is a site-specific recombinase from
                     Saccharomyces cerevisiae. Recombination occurs at FRT
     CDS             7928..8641
                     /product="temperature-sensitive variant of the phage lambda
                     /note="lambda repressor (ts)"
                     /note="thermosensitivity is conferred by the A67T mutation"
        1 gagacacaac gtggctttgt tgaataaatc gaacttttgc tgagttgaag gatcagatca
       61 cgcatcttcc cgacaacgca gaccgttccg tggcaaagca aaagttcaaa atcaccaact
      121 ggtccaccta caacaaagct ctcatcaacc gtggctccct cactttctgg ctggatgatg
      181 gggcgattca ggcctggtat gagtcagcaa caccttcttc acgaggcaga cctcagcgcc
      241 acaggtgcgg ttgctggcgc taaccgtttt tatcaggctc tgggaggcag aataaatgat
      301 catatcgtca attattacct ccacggggag agcctgagca aactggcctc aggcatttga
      361 gaagcacacg gtcacactgc ttccggtagt caataaaccg gtaaaccagc aatagacata
      421 agcggctatt taacgaccct gccctgaacc gacgaccggg tcgaatttgc tttcgaattt
      481 ctgccattca tccgcttatt atcacttatt caggcgtagc aaccaggcgt ttaagggcac
      541 caataactgc cttaaaaaaa ttacgccccg ccctgccact catcgcagta ctgttgtaat
      601 tcattaagca ttctgccgac atggaagcca tcacaaacgg catgatgaac ctgaatcgcc
      661 agcggcatca gcaccttgtc gccttgcgta taatatttgc ccatggtgaa aacgggggcg
      721 aagaagttgt ccatattggc cacgtttaaa tcaaaactgg tgaaactcac ccagggattg
      781 gctgagacga aaaacatatt ctcaataaac cctttaggga aataggccag gttttcaccg
      841 taacacgcca catcttgcga atatatgtgt agaaactgcc ggaaatcgtc gtggtattca
      901 ctccagagcg atgaaaacgt ttcagtttgc tcatggaaaa cggtgtaaca agggtgaa

No customer comments for the moment.

Add A Comment

Related Products


No products

Total $0.00

Prices don't include postage.
