pCP20 Plasmid


  • Model: PVT6006
  • 49 Units in Stock
Ask a question

Add to Cart:

pCP20 Plasmid

PVT6006   2ug


pCP20 Plasmid information

Replicon: pSC101 ori
Plasmid classification: large intestine series plasmid; large intestine editing plasmid; large intestine Red plasmid
Plasmid size: 9332bp
Clone strain: DH5 alpha and other Escherichia coli
Culture conditions: 30, LB, aerobic
Primers for 5'sequencing: FLP-R (GAGCTTTGTTGTAGGTGGACC)
Primers for 3'sequencing: FLP-F (TTGATGCGCTGGCAGTGTTC)
Use:Homologous recombination HR plasmid

pCP20 plasmid

pCP20 Plasmid Sequence

LOCUS Exported 9332 bp ds-DNA circular SYN 27-JUN-2017
DEFINITION synthetic circular DNA
SOURCE synthetic DNA construct
ORGANISM synthetic DNA construct
REFERENCE 1 (bases 1 to 9332)
TITLE Direct Submission
JOURNAL Exported Tuesday, June 27, 2017  FEATURES Location/Qualifiers
source 1..9332
/organism="synthetic DNA construct"
/mol_type="other DNA"
CDS complement(561..1220)
/product="chloramphenicol acetyltransferase"
/note="confers resistance to chloramphenicol"
promoter complement(1221..1323)
/note="cat promoter"
/note="promoter of the E. coli cat gene encoding
chloramphenicol acetyltransferase"
rep_origin 1875..2097
/note="pSC101 ori"
/note="low-copy replication origin that requires the Rep101
CDS 2145..3095
/gene="rep101 encoding an A56V mutation"
/product="temperature-sensitive version of a protein needed
for replication with the pSC101 origin"
CDS complement(4557..5417)
/note="confers resistance to ampicillin, carbenicillin, and
related antibiotics"
promoter complement(5418..5522)
/note="AmpR promoter"
CDS complement(6556..7827)
/product="site-specific recombinase"
/note="FLP is a site-specific recombinase from
Saccharomyces cerevisiae. Recombination occurs at FRT
CDS 7928..8641
/product="temperature-sensitive variant of the phage lambda
/note="lambda repressor (ts)"
/note="thermosensitivity is conferred by the A67T mutation"
1 gagacacaac gtggctttgt tgaataaatc gaacttttgc tgagttgaag gatcagatca
61 cgcatcttcc cgacaacgca gaccgttccg tggcaaagca aaagttcaaa atcaccaact
121 ggtccaccta caacaaagct ctcatcaacc gtggctccct cactttctgg ctggatgatg
181 gggcgattca ggcctggtat gagtcagcaa caccttcttc acgaggcaga cctcagcgcc
241 acaggtgcgg ttgctggcgc taaccgtttt tatcaggctc tgggaggcag aataaatgat
301 catatcgtca attattacct ccacggggag agcctgagca aactggcctc aggcatttga
361 gaagcacacg gtcacactgc ttccggtagt caataaaccg gtaaaccagc aatagacata
421 agcggctatt taacgaccct gccctgaacc gacgaccggg tcgaatttgc tttcgaattt
481 ctgccattca tccgcttatt atcacttatt caggcgtagc aaccaggcgt ttaagggcac
541 caataactgc cttaaaaaaa ttacgccccg ccctgccact catcgcagta ctgttgtaat
601 tcattaagca ttctgccgac atggaagcca tcacaaacgg catgatgaac ctgaatcgcc
661 agcggcatca gcaccttgtc gccttgcgta taatatttgc ccatggtgaa aacgggggcg
721 aagaagttgt ccatattggc cacgtttaaa tcaaaactgg tgaaactcac ccagggattg
781 gctgagacga aaaacatatt ctcaataaac cctttaggga aataggccag gttttcaccg
841 taacacgcca catcttgcga atatatgtgt agaaactgcc ggaaatcgtc gtggtattca
901 ctccagagcg atgaaaacgt ttcagtttgc tcatggaaaa cggtgtaaca agggtgaaca
961 ctatcccata tcaccagctc accgtctttc attgccatac ggaattccgg atgagcattc
1021 atcaggcggg caagaatgtg aataaaggcc ggataaaact tgtgcttatt tttctttacg
1081 gtctttaaaa aggccgtaat atccagctga acggtctggt tataggtaca ttgagcaact
1141 gactgaaatg cctcaaaatg ttctttacga tgccattggg atatatcaac ggtggtatat
1201 ccagtgattt ttttctccat tttagcttcc ttagctcctg aaaatctcga taactcaaaa
1261 aatacgcccg gtagtgatct tatttcatta tggtgaaagt tggaacctct tacgtgccga
1321 tcaacgtctc attttcgcca aaagttggcc cagggcttcc cggtatcaac agggacacca
1381 ggatttattt attctgcgaa gtgatcttcc gtcacaggta tttattcggc gcaaagtgcg
1441 tcgggtgatg ctgccaactt actgatttag tgtatgatgg tgtttttgag gtgctccagt
1501 ggcttctgtt tctatcagct gtccctcctg ttcagctact gacggggtgg tgcgtaacgg
1561 caaaagcacc gccggacatc agcgcttgtt tcggcgtggg tatggtggca ggccccgtgg
1621 ccgggggact gttgggcgcc tgtagtgcca tttaccccca ttcactgcca gagccgtgag
1681 cgcagcgaac tgaatgtcac gaaaaagaca gcgactcagg tgcctgatgg tcggagacaa
1741 aaggaatatt cagcgatttg cccgagcttg cgagggtgct acttaagcct ttagggtttt
1801 aaggtctgtt ttgtagagga gcaaacagcg tttgcgacat ccttttgtaa tactgcggaa
1861 ctgactaaag tagtgagtta tacacagggc tgggatctat tctttttatc tttttttatt
1921 ctttctttat tctataaatt ataaccactt gaatataaac aaaaaaaaca cacaaaggtc
1981 tagcggaatt tacagagggt ctagcagaat ttacaagttt tccagcaaag gtctagcaga
2041 atttacagat acccacaact caaaggaaaa ggactagtaa ttatcattga ctagcccatc
2101 tcaattggta tagtgattaa aatcacctag accaattgag atgtatgtct gaattagttg
2161 ttttcaaagc aaatgaacta gcgattagtc gctatgactt aacggagcat gaaaccaagc
2221 taattttatg ctgtgtggca ctactcaacc ccacgattga aaaccctaca aggaaagaac
2281 ggacggtatc gttcacttat aaccaatacg ttcagatgat gaacatcagt agggaaaatg
2341 cttatggtgt attagctaaa gcaaccagag agctgatgac gagaactgtg gaaatcagga
2401 atcctttggt taaaggcttt gagattttcc agtggacaaa ctatgccaag ttctcaagcg
2461 aaaaattaga attagttttt agtgaagaga tattgcctta tcttttccag ttaaaaaaat
2521 tcataaaata taatctggaa catgttaagt cttttgaaaa caaatactct atgaggattt
2581 atgagtggtt attaaaagaa ctaacacaaa agaaaactca caaggcaaat atagagatta
2641 gccttgatga atttaagttc atgttaatgc ttgaaaataa ctaccatgag tttaaaaggc
2701 ttaaccaatg ggttttgaaa ccaataagta aagatttaaa cacttacagc aatatgaaat
2761 tggtggttga taagcgaggc cgcccgactg atacgttgat tttccaagtt gaactagata
2821 gacaaatgga tctcgtaacc gaacttgaga acaaccagat aaaaatgaat ggtgacaaaa
2881 taccaacaac cattacatca gattcctacc tacataacgg actaagaaaa acactacacg
2941 atgctttaac tgcaaaaatt cagctcacca gttttgaggc aaaatttttg agtgacatgc
3001 aaagtaagta tgatctcaat ggttcgttct catggctcac gcaaaaacaa cgaaccacac
3061 tagagaacat actggctaaa tacggaagga tctgaggttc ttatggctct tgtatctatc
3121 agtgaagcat caagactaac aaacaaaagt agaacaactg ttcaccgtta catatcaaag
3181 ggaaaactgt ccatatgcac agatgaaaac ggtgtaaaaa agatagatac atcagagctt
3241 ttacgagttt ttggtgcatt taaagctgtt caccatgaac agatcgacaa tgtaacagat
3301 gaacagcatg taacacctaa tagaacaggt gaaaccagta aaacaaagca actagaacat
3361 gaaattgaac acctgagaca acttgttaca gctcaacagt cacacataga cagcctgaaa
3421 caggcgatgc tgcttatcga atcaaagctg ccgacaacac gggagccagt gacgcctccc
3481 gtggggaaaa aatcatggca attctggaag aaatagcgcc tgtttcgttt caggcaggtt
3541 atcagggagt gtcagcgtcc tgcggttctc cggggcgttc gggtcatgca gcccgtaatg
3601 gtgatttacc agcgtctgcc aggcatcaat tctaggcctg tctgcgcggt cgtagtacgg
3661 ctggaggcgt tttccggtct gtagctccat gttcggaatg acaaaattca gctcaagccg
3721 tcccttgtcc tggtgctcca cccacaggat gctgtactga tttttttcga gaccgggcat
3781 cagtacacgc tcaaagctcg ccatcacttt ttcacgtcct cccggcggca gctccttctc
3841 cgcgaacgac agaacaccgg acgtgtattt cttcgcaaat ggcgtggcat cgatgagttc
3901 ccggacttct tccggattac cctgaagcac cgttgcgcct tcgcggttac gctccctccc
3961 cagcaggtaa tcaaccggac cactgccacc accttttccc ctggcatgaa atttaactat
4021 catcccgcgc cccctgttcc ctgacagcca gacgcagccg gcgcagctca tccccgatgg
4081 ccatcagtgc ggccaccacc tgaacccggt caccggaaga ccactgcccg ctgttcacct
4141 tacgggctgt ctgattcagg ttatttccga tggcggccag ctgacgcagt aacggcggtg
4201 ccagtgtcgg cagttttccg gaacgggcaa ccggctcccc caggcagacc cgccgcatcc
4261 ataccgccag ttgtttaccc tcacagcgtt caagtaaccg ggcatgttca tcatcagtaa
4321 cccgtattgt gagcatcctc tcgcgtttca tcggtatcat taccccatga acagaaatcc
4381 cccttacacg gaggcatcag tgactaaacg gggtctgacg ctcagtggaa cgaaaactca
4441 cgttaaggga ttttggtcat gagattatca aaaaggatct tcacctagat ccttttaaat
4501 taaaaatgaa gttttaaatc aatctaaagt atatatgagt aaacttggtc tgacagttac
4561 caatgcttaa tcagtgaggc acctatctca gcgatctgtc tatttcgttc atccatagtt
4621 gcctgactcc ccgtcgtgta gataactacg atacgggagg gcttaccatc tggccccagt
4681 gctgcaatga taccgcgaga cccacgctca ccggctccag atttatcagc aataaaccag
4741 ccagccggaa gggccgagcg cagaagtggt cctgcaactt tatccgcctc catccagtct
4801 attaattgtt gccgggaagc tagagtaagt agttcgccag ttaatagttt gcgcaacgtt
4861 gttgccattg ctgcaggcat cgtggtgtca cgctcgtcgt ttggtatggc ttcattcagc
4921 tccggttccc aacgatcaag gcgagttaca tgatccccca tgttgtgcaa aaaagcggtt
4981 agctccttcg gtcctccgat cgttgtcaga agtaagttgg ccgcagtgtt atcactcatg
5041 gttatggcag cactgcataa ttctcttact gtcatgccat ccgtaagatg cttttctgtg
5101 actggtgagt actcaaccaa gtcattctga gaatagtgta tgcggcgacc gagttgctct
5161 tgcccggcgt caacacggga taataccgcg ccacatagca gaactttaaa agtgctcatc
5221 attggaaaac gttcttcggg gcgaaaactc tcaaggatct taccgctgtt gagatccagt
5281 tcgatgtaac ccactcgtgc acccaactga tcttcagcat cttttacttt caccagcgtt
5341 tctgggtgag caaaaacagg aaggcaaaat gccgcaaaaa agggaataag ggcgacacgg
5401 aaatgttgaa tactcatact cttccttttt caatattatt gaagcattta tcagggttat
5461 tgtctcatga gcggatacat atttgaatgt atttagaaaa ataaacaaat aggggttccg
5521 cgcacatttc cccgaaaagt gccacctgac gtctaagaaa ccattattat catgacatta
5581 acctataaaa ataggcgtat cacgaggccc tttcgtcttc aagaatttta taaaccgtgg
5641 agcgggcaat actgagctga tgagcaattt ccgttgcacc agtgcccttc tgatgaagcg
5701 tcagcacgac gttcctgtcc acggtacgcc tgcggccaaa tttgattcct ttcagctttg
5761 cttcctgtcg gccctcattc gtgcgctcta ggatcctcta cgccggacgc atcgtggccg
5821 gcatcaccgg cgctgaggtc tgcctcgtga agaaggtgtt gctgactcat accaggcctg
5881 aatcgcccca tcatccagcc agaaagtgag ggagccacgg ttgatgagag ctttgttgta
5941 ggtggaccag ttggtgattt tgaacttttg ctttgccacg gaacggtctg cgttgtcggg
6001 aagatgcgtg atctgatcct tcaactcagc aaaagttcga tttattcaac aaagccgccg
6061 tcccgtcaag tcagcgtaat gctctgccag tgttacaacc aattaaccaa ttctgattag
6121 aaaaactcat cgagcatcaa atgaaactgc aatttattca tatcaggatt atcaatacca
6181 tatttttgaa aaagccgttt ctgtaatgaa ggagaaaact caccgaggca gttccatagg
6241 atggcaagat cctggtatcg gtctgcgatt ccgactcgtc caacatcaat acaacctatt
6301 aatttcccct cgtcaaaaat aaggttatca agtgagaaat caccatgagt gacgactgaa
6361 tccggtgaga atggcagaat aggaacttcg gaataggaac ttcaaagcgt ttccgaaaac
6421 gagcgcttcc gaaaatgcaa cgcgagctgc gcacatacag ctcactgttc acgtcgcacc
6481 tatatctgcg tgttgcctgt atatatatat acatgagaag aacggcatag tgcgtgttta
6541 tgcttaaatg cgtacttata tgcgtctatt tatgtaggat gaaaggtagt ctagtacctc
6601 ctgtgatatt atcccattcc atgcggggta tcgtatgctt ccttcagcac taccctttag
6661 ctgttctata tgctgccact cctcaattgg attagtctca tccttcaatg ctatcatttc
6721 ctttgatatt ggatcatatg catagtaccg agaaactagt gcgaagtagt gatcaggtat
6781 tgctgttatc tgatgagtat acgttgtcct ggccacggca gaagcacgct tatcgctcca
6841 atttcccaca acattagtca actccgttag gcccttcatt gaaagaaatg aggtcatcaa
6901 atgtcttcca atgtgagatt ttgggccatt ttttatagca aagattgaat aaggcgcatt
6961 tttcttcaaa gctttattgt acgatctgac taagttatct tttaataatt ggtattcctg
7021 tttattgctt gaagaattgc cggtcctatt tactcgtttt aggactggtt cagaattcct
7081 caaaaattca tccaaatata caagtggatc gatcctaccc cttgcgctaa agaagtatat
7141 gtgcctacta acgcttgtct ttgtctctgt cactaaacac tggattatta ctcccagata
7201 cttattttgg actaatttaa atgatttcgg atcaacgttc ttaatatcgc tgaatcttcc
7261 acaattgatg aaagtagcta ggaagaggaa ttggtataaa gtttttgttt ttgtaaatct
7321 cgaagtatac tcaaacgaat ttagtatttt ctcagtgatc tcccagatgc tttcaccctc
7381 acttagaagt gctttaagca tttttttact gtggctattt cccttatctg cttcttccga
7441 tgattcgaac tgtaattgca aactacttac aatatcagtg atatcagatt gatgtttttg
7501 tccatagtaa ggaataattg taaattccca agcaggaatc aatttcttta atgaggcttc
7561 cagaattgtt gctttttgcg tcttgtattt aaactggagt gatttattga caatatcgaa
7621 actcagcgaa ttgcttatga tagtattata gctcatgaat gtggctctct tgattgctgt
7681 tccgttatgt gtaatcatcc aacataaata ggttagttca gcagcacata atgctatttt
7741 ctcacctgaa ggtctttcaa acctttccac aaactgacga acaagcacct taggtggtgt
7801 tttacataat atatcaaatt gtggcataca acctccttag tacatgcaac cattatcacc
7861 gccagaggta aaatagtcaa cacgcacggt gttagatatt tatcccttgc ggtgatagat
7921 ttaacgtatg agcacaaaaa agaaaccatt aacacaagag cagcttgagg acgcacgtcg
7981 ccttaaagca atttatgaaa aaaagaaaaa tgaacttggc ttatcccagg aatctgtcgc
8041 agacaagatg gggatggggc agtcaggcgt tggtgcttta tttaatggca tcaatgcatt
8101 aaatgcttat aacgccgcat tgcttacaaa aattctcaaa gttagcgttg aagaatttag
8161 cccttcaatc gccagagaaa tctacgagat gtatgaagcg gttagtatgc agccgtcact
8221 tagaagtgag tatgagtacc ctgttttttc tcatgttcag gcagggatgt tctcacctaa
8281 gcttagaacc tttaccaaag gtgatgcgga gagatgggta agcacaacca aaaaagccag
8341 tgattctgca ttctggcttg aggttgaagg taattccatg accgcaccaa caggctccaa
8401 gccaagcttt cctgacggaa tgttaattct cgttgaccct gagcaggctg ttgagccagg
8461 tgatttctgc atagccagac ttgggggtga tgagtttacc ttcaagaaac tgatcaggga
8521 tagcggtcag gtgtttttac aaccactaaa cccacagtac ccaatgatcc catgcaatga
8581 gagttgttcc gttgtgggga aagttatcgc tagtcagtgg cctgaagaga cgtttggctg
8641 atcggcaagg tgttctggtc ggcgcatagc tgataacaat tgagcaagaa tctgcatttc
8701 tttccagact tgttcaacag gccagccatt acgctcgtca tcaaaatcac tcgcatcaac
8761 caaaccgtta ttcattcgtg attgcgcctg agcgagacga aatacgcgat cgctgttaaa
8821 aggacaatta caaacaggaa tcgaatgcaa ccggcgcagg aacactgcca gcgcatcaac
8881 aatattttca cctgaatcag gatattcttc taatacctgg aatgctgttt tcccggggat
8941 cgcagtggtg agtaaccatg catcatcagg agtacggata aaatgcttga tggtcggaag
9001 aggcataaat tccgtcagcc agtttagtct gaccatctca tctgtaacat cattggcaac
9061 gctacctttg ccatgtttca gaaacaactc tggcgcatcg ggcttcccat acaatcgata
9121 gattgtcgca cctgattgcc cgacattatc gcgagcccat ttatacccat ataaatcagc
9181 atccatgttg gaatttaatc gcggcctcga gcaagacgtt tcccgttgaa tatggctcat
9241 aacacccctt gtattactgt ttatgtaagc agacagtttt attgttcatg atgatatatt
9301 tttatcttgt gcaatgtaac atcagagatt tt


  1. This product is FOR RESEARCH USE ONLY!
No customer comments for the moment.

Add A Comment

Related Products


No products

Total $0.00

Prices don't include postage.
