pCRISPRyl

$215.00

  • Model: PVT11269
  • 49 Units in Stock
Ask a question


Add to Cart:

pCRISPRyl

Catalog No. PVT11269
Packing 2ug

 

pCRISPRyl Information
Function yeast Editing plasmids
Resistance Amp
Screen /
Strain Stbl3
Culture temperature 37degrees centigrade

Vector backbone pUC19

Backbone size w/o insert (bp) 2623

Total vector size (bp) 11804

Vector type Yeast Expression, CRISPR, Synthetic Biology

Selectable markers LEU2

GROWTH IN BACTERIA

Bacterial Resistance(s) Ampicillin

Growth Temperature 37°C

Growth Strain(s) DH5alpha

Copy number High Copy

Use:CRISPR-CAS44-sgRNA plasmid

 

pCRISPRyl sequence 11805 bps

GACGAAAGGGCCAGATCTGTTCGGAAATCAACGGATGCTCAACCGATTTCGACAGTAATAATTTGAATCG

AATCGGAGCCTAAAATGAACCCGAGTATATCTCATAAAATTCTCGGTGAGAGGTCTGTGACTGTCAGTAC

AAGGTGCCTTCATTATGCCCTCAACCTTACCATACCTCACTGGATGTAGTGTACCTCTAAAAATGAAATA

CAGTGCCAAAAGCCATGGCACTGAGCTCGTCTAACGGACTTGATATACAACCAATTAAAACAAATGAAAA

GAAATACAGTTCTTTGTATCATTTGTAACAATTACCCTGTACAAACTAAGGTATTGAAATCCCACAATAT

TCCCAAAGTCCACCCCTTTCCAAATTGTCATGCCTACAACTCATATACCAGACACTAACCTACCAAACAC

CACTAAAAACCCCACAAAATATATCTTACCGAATATACAGTAACAAGCTACCACCACACTCGTTGGGTGC

AGTCGCCAGCTTTAAAGATATCTATCCACATCAGCCACAACTCCCTTCCTTTAATAAACCGACTACACCC

TTGGCTATTGAGGTTATGAGTGAATATACTGTAGACAAGACACTTTCAAGAAGACTGTTTCCAAAACGTA

CCACTGTCCTCCACTACAAACACACCCAATCTGCTTCTTCTAGTCAAGGTTGCTACACCGGTAAATTATA

AATCATCATTTCATTAGCAGGGCTGGGCCCTTTTTATAGAGTCTTATACACTAGCGGACCCTGCCGGTAG

ACCAACCCGCAGGCGCGTCAGTTTGCTCCTTCCATCAATGCGTCGTAGAAACGACTTACTCCTTCTTGAG

CAGCTCCTTGACCTTGTTGGCAACAAAGTCTCCGACCTCGGAGGTGGAGGAAGAGCCTCCGATATCGGCG

GTAGTGATACCAGCCTCGACGGACTCCTTGACGGCAGCCTCAACAGCGTCACCGGCGGGCTTCATGTTAA

GAGAGAACTTGAGCATCATGGCGGCAGACAGAATGGTGGCAATGGGGTTGACCTTCTGCTTGCCGAGATC

GGGGGCAGATCCGTGACAGGGCTCGTACAGACCGAACGCCTCGTTGGTGTCGGGCAGAGAAGCCAGAGAG

GCGGAGGGCAGCAGACCCAGAGAACCGGGGATGACGGAGGCCTCGTCGGAGATGATATCGCCAAACATGT

TGGTGGTGATGATGATACCATTCATCTTGGAGGGCTGCTTGATGAGGATCATGGCGGCCGAGTCGATCAG

CTGGTGGTTGAGCTCGAGCTGGGGGAATTCGTCCTTGAGGACTCGAGTGACAGTCTTTCGCCAAAGTCGA

GAGGAGGCCAGCACGTTGGCCTTGTCAAGAGACCACACGGGAAGAGGGGGGTTGTGCTGAAGGGCCAGGA

AGGCGGCCATTCGGGCAATTCGCTCAACCTCAGGAACGGAGTAGGTCTCGGTGTCGGAAGCGACGCCAGA

TCCGTCATCCTCCTTTCGCTCTCCAAAGTAGATACCTCCGACGAGCTCTCGGACAATGATGAAGTCGGTG

CCCTCAACGTTTCGGATGGGGGAGAGATCGGCGAGCTTGGGCGACAGCAGCTGGCAGGGTCGCAGGTTGG

CGTACAGGTTCAGGTCCTTTCGCAGCTTGAGGAGACCCTGCTCGGGTCGCACGTCGGTTCGTCCGTCGGG

AGTGGTCCATACGGTGTTGGCAGCGCCTCCGACAGCACCGAGCATAATAGAGTCAGCCTTTCGGCAGATG

TCGAGAGTAGCGTCGGTGATGGGCTCGCCCTCCTTCTCAATGGCAGCTCCTCCAATGAGTCGGTCCTCAA

ACACAAACTCGGTGCCGGAGGCCTCAGCAACAGACTTGAGCACCTTGACGGCCTCGGCAATCACCTCGGG

GCCACAGAAGTCGCCGCCGAGAAGAACAATCTTCTTGGAGTCAGTCTTGGTCTTCTTAGTTTCGGGTTCC

ATTGTGGATGTGTGTGGTTGTATGTGTGATGTGGTGTGTGGAGTGAAAATCTGTGGCTGGCAAACGCTCT

TGTATATATACGCACTTTTGCCCGTGCTATGTGGAAGACTAAACCTCCGAAGATTGTGACTCAGGTAGTG

CGGTATCGGCTAGGGACCCAAACCTTGTCGATGCCGATAGCGCTATCGAACGTACCCCAGCCGGCCGGGA

GTATGTCGGAGGGGACATACGAGATCGTCAAGGGTTTGTGGCCAACTGGTAAATAAATGATGACTCAGGC

GACGACGGAATTCGACAGCAACTACTCCTTTCACCAACCATGTGCATTTTAGCTCGAATAACATTCACAG

GCTTGGTGATCTACATCCATGGTGTCTGGCCGATTACCGTGGTGTTTTGGCAGTAACGAGAATATTGAGT

GAACTCTTCCCATCACCAATAAAGACTCATACTACAATCACGAGCGCTTCAGCTGCCACTATAGTGTTGG

TGACACAATACCCCTCGATGCTGGGCATTACTGTAGCAAGAGATATTATTTCATGGCGCATTTTCCAGTC

TACCTGACTTTTTAGTGTGATTTCTTCTCCACATTTTATGCTCAGTGTGAAAAGTTGGAGTGCACACTTA

ATTATCGCCGGTTTTCGGAAAGTACTATGTGCTCAAGGTTGCACCCCACGTTACGTATGCAGCACATTGA

GCAGCCTTTGGACCGTGGAGATAACGGTGTGGAGATAGCAACGGGTAGTCTTCGTATTAATTCAATGCAT

TGTTAGTTTTATATGATATGGTGTCGAAGCGGCCGCATACTACTGTATATTCAAGCAAGTATATCCGTGG

GTGCGGGTGATTTGGATCTAAGGTTCGTACTCAACACTCACGAGCAGCTTGCCTATGTTACATCCTTTTA

TCAGACATAGCGGCCGCTTCGACTCTAGAGGATCTGGGCCTCGTGATACGCCTATTTTTATAGGTTAATG

TCATGATAATAATGGTTTCTTAgacgtAAAAAAAAGCACCGACTCGGTGCCACTTTTTCAAGTTGATAAC

GGACTAGCCTTATTTTAACTTGCTATTTCTAGCTCTAAAACctaggtcAACCTGCGCCGACCCGGAATCG

AACCGGGGGCCCATCGATGGCAACGATGGATTTTACCACTAAACCATCGGCGCATTAGAGGTATTTTTCa

AAGTAGCCCAGTGCAGAGTCCAGAACTCGAACGCACAACAAGAAGGCGATTTACCACTCCGACAAAATGC

CATTACAGCTAGTAAAAAACTTTGTTTACACCACTATAGCTGATAATACATATCACGTGACGGAGCCAAA

AAATGGAGTCTCATACACGAAGAAGTGTCCGATTTGAGATTTTGAAAAAGACAATATATTAAAAAGGCAT

TAGAGCGTTATTTTAACCAACTTTTAAAGCCCTAGCACATCAATTAAGACCAATATTATATAATCACACC

CTAACCCTTGTTATGATTCTATATTTGGAAGCAGATCTAGAGTTGTGTCAACTTTTGCAACTGGGGacgt

cAGGTGGCACTTTTCGGGGAAATGTGTGCGGAACCCCTATTTGTTTATTTTTCTAAATACATTCAAATAT

GTATCCGCTCATGAGACAATAACCCTGATAAATGCTTCAATAATATTGAAAAAGGAAGAGTATGAGTATT

CAACATTTCCGTGTCGCCCTTATTCCCTTTTTTGCGGCATTTTGCCTTCCTGTTTTTGCTCACCCAGAAA

CGCTGGTGAAAGTAAAAGATGCTGAAGATCAGTTGGGTGCACGAGTGGGTTACATCGAACTGGATCTCAA

CAGCGGTAAGATCCTTGAGAGTTTTCGCCCCGAAGAACGTTTTCCAATGATGAGCACTTTTAAAGTTCTG

CTATGTGGCGCGGTATTATCCCGTATTGACGCCGGGCAAGAGCAACTCGGTCGCCGCATACACTATTCTC

AGAATGACTTGGTTGAGTACTCACCAGTCACAGAAAAGCATCTTACGGATGGCATGACAGTAAGAGAATT

ATGCAGTGCTGCCATAACCATGAGTGATAACACTGCGGCCAACTTACTTCTGACAACGATCGGAGGACCG

AAGGAGCTAACCGCTTTTTTGCACAACATGGGGGATCATGTAACTCGCCTTGATCGTTGGGAACCGGAGC

TGAATGAAGCCATACCAAACGACGAGCGTGACACCACGATGCCTGTAGCAATGGCAACAACGTTGCGCAA

ACTATTAACTGGCGAACTACTTACTCTAGCTTCCCGGCAACAATTAATAGACTGGATGGAGGCGGATAAA

GTTGCAGGACCACTTCTGCGCTCGGCCCTTCCGGCTGGCTGGTTTATTGCTGATAAATCTGGAGCCGGTG

AGCGTGGGTCTCGCGGTATCATTGCAGCACTGGGGCCAGATGGTAAGCCCTCCCGTATCGTAGTTATCTA

CACGACGGGGAGTCAGGCAACTATGGATGAACGAAATAGACAGATCGCTGAGATAGGTGCCTCACTGATT

AAGCATTGGTAACTGTCAGACCAAGTTTACTCATATATACTTTAGATTGATTTAAAACTTCATTTTTAAT

TTAAAAGGATCTAGGTGAAGATCCTTTTTGATAATCTCATGACCAAAATCCCTTAACGTGAGTTTTCGTT

CCACTGAGCGTCAGACCCCGTAGAAAAGATCAAAGGATCTTCTTGAGATCCTTTTTTTCTGCGCGTAATC

TGCTGCTTGCAAACAAAAAAACCACCGCTACCAGCGGTGGTTTGTTTGCCGGATCAAGAGCTACCAACTC

TTTTTCCGAAGGTAACTGGCTTCAGCAGAGCGCAGATACCAAATACTGTCCTTCTAGTGTAGCCGTAGTT

AGGCCACCACTTCAAGAACTCTGTAGCACCGCCTACATACCTCGCTCTGCTAATCCTGTTACCAGTGGCT

GCTGCCAGTGGCGATAAGTCGTGTCTTACCGGGTTGGACTCAAGACGATAGTTACCGGATAAGGCGCAGC

GGTCGGGCTGAACGGGGGGTTCGTGCACACAGCCCAGCTTGGAGCGAACGACCTACACCGAACTGAGATA

CCTACAGCGTGAGCATTGAGAAAGCGCCACGCTTCCCGAAGGGAGAAAGGCGGACAGGTATCCGGTAAGC

GGCAGGGTCGGAACAGGAGAGCGCACGAGGGAGCTTCCAGGGGGAAACGCCTGGTATCTTTATAGTCCTG

TCGGGTTTCGCCACCTCTGACTTGAGCGTCGATTTTTGTGATGCTCGTCAGGGGGGCGGAGCCTATGGAA

AAACGCCAGCAACGCGGCCTTTTTACGGTTCCTGGCCTTTTGCTGGCCTTTTGCTCACATGTTCTTTCCT

GCGTTATCCCCTGATTCTGTGGATAACCGTATTACCGCCTTTGAGTGAGCTGATACCGCTCGCCGCAGCC

GAACGACCGAGCGCAGCGAGTCAGTGAGCGAGGAAGCGGAAGAGCGCCCAATACGCAAACCGCCTCTCCC

CGCGCGTTGGCCGATTCATTAATGCAGCTGGCACGACAGGTTTCCCGACTGGAAAGCGGGCAGTGAGCGC

AACGCAATTAATGTGAGTTAGCTCACTCATTAGGCACCCCAGGCTTTACACTTTATGCTTCCGGCTCGTA

TGTTGTGTGGAATTGTGAGCGGATAACAATTTCACACAGGAAACAGCTATGACCATGATTACGCCAAGCT

TGCAAATTAAAGCCTTCGAGCGTCCCAAAACCTTCTCAAGCAAGGTTTTCAGTATAATGTTACATGCGTA

CACGCGTCTGTACAGAAAAAAAAGAAAAATTTGAAATATAAATAACGTTCTTAATACTAACATAACTATA

AAAAAATAAATAGGGACCTAGACTTCAGGTTGTCTAACTCCTTCCTTTTCGGTTAGAGCGGATGTGGAGG

GAGGGCGTGAATGTAAGCGTGACATAACTAATTACATGAGGCTAGCTTACACCTTTCGCTTCTTCTTGGG

GTCGGCTCGAGAGTCGCCGCCCAGCTGAGACAGGTCGATTCGGGTCTCGTACAGGCCGGTGATAGACTGG

TGGATCAGGGTGGCGTCCAGCACCTCCTTGGTAGAGGTGTATCGCTTTCGGTCGATGGTGGTGTCGAAGT

ACTTGAAGGCAGCGGGGGCTCCCAGGTTGGTCAGGGTGAACAGGTGAATGATGTTCTCAGCCTGCTCTCG

AATGGGCTTGTCTCGGTGCTTGTTGTAAGCAGACAGCACCTTATCCAGGTTGGCGTCAGCCAGGATCACT

CGCTTAGAGAACTCAGAGATCTGCTCGATGATCTCGTCCAGGTAGTGCTTATGCTGCTCCACGAAGAGCT

GCTTCTGCTCGTTATCCTCGGGAGAGCCCTTCAGCTTCTCGTAATGGGAGGCGAGGTACAGGAAGTTGAC

GTACTTGGAGGGCAGGGCCAGCTCGTTTCCCTTCTGCAGCTCGCCGGCAGAGGCCAGCATTCGCTTTCGT

CCGTTCTCCAGCTCGAACAGAGAGTACTTGGGGAGCTTGATAATCAGATCTTTCTTCACCTCCTTGTATC

CCTTGGCCTCCAGGAAGTCAATGGGGTTCTTCTCGAAAGAAGATCGCTCCATGATGGTAATGCCCAGCAG

CTCCTTCACAGACTTCAGCTTCTTAGACTTGCCCTTCTCCACCTTGGCCACCACCAGCACAGAGTAAGCC

ACGGTGGGAGAGTCGAAACCTCCGTACTTCTTGGGGTCCCAGTCCTTCTTTCGGGCGATCAGCTTGTCAG

AGTTTCGCTTGGGCAGGATGGACTCCTTAGAGAAACCTCCGGTCTGCACCTCGGTCTTCTTCACGATGTT

CACCTGGGGCATAGACAGCACCTTTCGCACGGTGGCGAAGTCTCGTCCCTTGTCCCACACGATCTCACCG

GTCTCTCCGTTGGTCTCAATGAGGGGTCGCTTTCGAATCTCGCCGTTAGCCAGGGTAATCTCGGTCTTGA

AGAAGTTCATAATGTTGGAGTAGAAGAAGTACTTGGCGGTAGCCTTGCCAATCTCCTGCTCGGACTTGGC

AATCATTTTTCGCACATCGTAGACCTTGTAGTCGCCGTAGACGAACTCGGACTCCAGCTTGGGATACTTC

TTGATGAGGGCGGTGCCCACGACAGCGTTCAGGTAGGCATCGTGGGCGTGGTGGTAGTTGTTAATCTCTC

GCACCTTGTAGAACTGGAAGTCCTTTCGGAAGTCAGACACCAGCTTAGACTTCAGGGTGATCACCTTCAC

CTCTCGGATCAGCTTGTCGTTCTCGTCGTACTTGGTGTTCATTCGAGAGTCCAGGATCTGGGCCACGTGC

TTGGTGATCTGTCGGGTCTCCACCAGCTGTCGCTTGATGAAGCCGGCCTTGTCCAGCTCAGACAGGCCGC

CTCGCTCGGCCTTGGTCAGGTTGTCGAACTTTCGCTGGGTAATCAGCTTGGCGTTCAGCAGCTGTCGCCA

GTAGTTCTTCATCTTCTTGACCACCTCCTCGGAGGGCACGTTGTCAGACTTGCCTCGGTTCTTGTCGGAT

CGGGTCAGCACCTTGTTATCGATAGAATCGTCCTTCAGGAAGGACTGGGGCACAATGTGGTCCACATCGT

AGTCGGAGAGTCGGTTGATATCCAGCTCCTGGTCGACGTACATGTCTCGACCGTTCTGCAGATAGTACAG

GTACAGCTTCTCGTTCTGGAGCTGAGTGTTCTCCACGGGATGCTCCTTGAGAATCTGGGATCCCAGCTCC

TTAATACCTTCCTCAATTCGCTTCATTCGCTCTCGGGAGTTTTTCTGACCCTTCTGAGTAGTCTGGTTCT

CTCGAGCCATCTCAATGACAATGTTCTCGGGCTTGTGTCGGCCCATCACCTTGACGAGCTCATCGACCAC

CTTGACGGTCTGCAGGATACCTTTCTTAATGGCGGGAGAGCCGGCCAGGTTGGCGATGTGCTCGTGCAGA

GAGTCGCCCTGGCCAGACACCTGGGCCTTCTGGATGTCCTCCTTGAAGGTCAGAGAGTCGTCGTGGATCA

GCTGCATGAAGTTTCGGTTGGCGAAGCCGTCAGACTTCAGGAAGTCCAGGATGGTCTTGCCAGACTGCTT

GTCTCGGATGCCGTTGATCAGCTTTCGAGACAGTCGGCCCCAGCCGGTGTATCGTCGTCGCTTCAGCTGC

TTCATCACCTTGTCGTCGAACAGGTGAGCGTAGGTCTTGAGTCGCTCCTCAATCATCTCTCGATCCTCGA

ACAGGGTGAGGGTCAGGACAATGTCCTCGAGAATATCCTCGTTCTCCTCGTTATCCAGGAAATCCTTGTC

CTTGATAATCTTCAGCAGGTCGTGGTAGGTACCCAGAGAGGCGTTGAATCGGTCCTCGACGCCGGAGATC

TCGACAGAATCGAAACACTCAATCTTCTTGAAGTAATCCTCCTTCAGCTGCTTGACGGTGACCTTTCGGT

TAGTCTTGAAGAGCAGATCCACAATAGCCTTCTTCTGCTCTCCAGACAGGAAAGCGGGCTTTCGCATTCC

CTCGGTCACGTACTTGACCTTGGTGAGCTCGTTGTAGACGGTGAAGTACTCGTAGAGCAGAGAGTGCTTG

GGCAGGACCTTCTCGTTGGGGAGGTTCTTGTCGAAGTTGGTCATTCGCTCGATGAAAGACTGAGCAGAGG

CGCCCTTATCCACCACCTCCTCGAAGTTCCAGGGGGTAATGGTCTCCTCAGACTTTCGGGTCATCCAaGC

GAATCGAGAGTTtCCTCGGGCCAGGGGtCCCACGTAGTAGGGGATTCGGAAGGTCAGGATCTTCTCGATC

TTCTCTCGGTTGTCCTTCAGGAAGGGGTAGAAGTCCTCCTGTCGTCGCAGGATGGCGTGCAGCTCGCCCA

GGTGGATCTGGTGGGGGATAGAGCCGTTGTCGAAGGTTCGCTGCTTTCGCAGGAGGTCCTCTCGGTTCAG

CTTCACGAGCAGTTCCTCGGTTCCGTCCATCTTCTCCAGGATGGGCTTAATGAACTTGTAGAACTCCTCC

TGAGAGGCGCCGCCGTCGATGTAGCCGGCGTAGCCGTTCTTAGACTGGTCGAAGAAAATCTCCTTGTACT

TCTCGGGCAGCTGCTGTCGGACCAGAGCCTTGAGGAGGGTCAGATCCTGGTGGTGCTCATCGTATCGCTT

AATCATGGAGGCAGACAGGGGGGCCTTGGTGATCTCGGTGTTCACTCGCAGGATGTCAGACAGCAGGATG

GCGTCAGACAGGTTCTTGGCGGCCAGGAACAGGTCGGCGTACTGGTCGCCAATCTGGGCGAGCAGGTTAT

CCAGGTCATCGTCGTAGGTGTCCTTAGACAGCTGCAGCTTAGCGTCCTCAGCCAGATCGAAGTTGGACTT

GAAGTTAGGGGTGAGACCCAGGGACAGAGCAATCAGGTTTCCGAACAGACCGTTCTTCTTCTCTCCGGGG

AGCTGAGCAATCAGGTTCTCGAGTCGTCGAGACTTAGACAGTCGGGCAGACAGGATGGCCTTAGCATCCA

CGCCAGAAGCGTTAATGGGGTTCTCTTCGAAGAGCTGGTTGTAGGTCTGCACCAGCTGGATGAACAGCTT

GTCCACGTCAGAGTTGTCGGGGTTCAGGTCGCCCTCGATCAGGAAGTGGCCTCGGAACTTGATCATGTGG

GCCAGGGCCAGGTAGATCAGTCGCAGGTCGGCCTTGTCGGTAGAGTCCACCAGCTTCTTTCGCAGGTGGT

AGATGGTGGGGTACTTCTCGTGGTAGGCCACCTCGTCCACGATGTTGCCGAAGATGGGGTGTCGCTCGTG

CTTCTTGTCCTCCTCCACCAGGAAAGACTCCTCCAGTCGGTGGAAGAAAGAGTCGTCCACCTTGGCCATC

TCGTTAGAGAAGATCTCCTGCAGGTAACAGATTCGGTTCTTTCTTCGGGTGTATCGTCTTCGAGCGGTTC

GCTTCAGTCGGGTGGCCTCAGCGGTCTCGCCAGAGTCGAAGAGCAGAGCGCCGATCAGGTTCTTCTTGAT

GGAGTGTCGGTCGGTGTTGCCCAGGACCTTGAATTTCTTAGAGGGCACCTTGTACTCATCGGTGATCACG

GCCCAACCCACGGAGTTGGTTCCGATGTCCAGGCCAATGGAGTATTTCTTATCCATtgtggcgcgcCTTT

GAATGATTCTTATACTCAGAAGGAAATGCTTAACGATTTCGGGTGTGAGTTGACAAGGAGAGAGAGAAAA

GAAGAGGAAAGGTAATTCGGGGACGGTGGTCTTTTATACCCTTGGCTAAAGTCCCAACCACAAAAGCTTC

TGCAGGCATGCCCGGATCGAGGTGGGCGGGAACAACGGTCTCGATAATGTACGTACACTACACACAAAGA

GAAGCAAGTGGGGGCGGGACTGCACGGCACTTGTGAGACACCTCAGGTCGACCCGGATCGAGGTGGGCGG

GAACAACGGTCTCGATAATGTACGTACACTACACACAAAGAGAAGCAAGTGGGGGCGGGACTGCACGGCA

CTTGTGAGACACCTCAGGGATCCCCGGATCGAGGTGGGCGGGAACAACGGTCTCGATAATGTACGTACAC

TACACACAAAGAGAAGCAAGTGGGGGCGGGACTGCACGGCACTTGTGAGACACCTCAGTCTAGACCGGAT

CGAGGTGGGCGGGAACAACGGTCTCGATAATGTACGTACACTACACACAAAGAGAAGCAAGTGGGGGCGG

GACTGCACGGCACTTGTGAGACACCTCAGGAGCTCCCGGATCGAGGTGGGCGGGAACAACGGTCTCGATA

ATGTACGTACACTACACACAAAGAGAAGCAAGTGGGGGCGGGACTGCACGGCACTTGTGAGACACCTCAG

GTCGACCCGGATCGAGGTGGGCGGGAACAACGGTCTCGATAATGTACGTACACTACACACAAAGAGAAGC

AAGTGGGGGCGGGACTGCACGGCACTTGTGAGACACCTCAGGGATCCCCGGATCGAGGTGGGCGGGAACA

ACGGTCTCGATAATGTACGTACACTACACACAAAGAGAAGCAAGTGGGGGCGGGACTGCACGGCACTTGT

GAGACACCTCAGTCTAGACCGGATCGAGGTGGGCGGGAACAACGGTCTCGATAATGTACGTACACTACAC

ACAAAGAGAAGCAAGTGGGGGCGGGACTGCACGGCACTTGTGAGACACCTCAGGAATTCGGGTACCGCAT

GCTTCCTTGGTACCTTCGAACCCGGGGGATCCCCCTTTCATCAAATTTAGGGATGCCATCAACTTTCAGT

TCATAATTAATATCTTACCAAATTAGGTAATCTGCAAAAGTTCAGACTGTGAAATGTAACATTTTATATA

TCAAGCTCTATTTAACGCCTCACAGTAGTTAACATAAAGAGATACAGAATTGTCGTGTCAGTGTATACTA

TCCATGTGTATACTCTGGATATCCATTTGTATTCCATTATCTACGAAAAGCGGGTACCGAGCTCGAATTC

ACTGGCCGTCGTTTTACAACGTCGTGACTGGGAAAACCCTGGCGTTACCCAACTTAATCGCCTTGCAGCA

CATCCCCCTTTCGCCAGCTGGCGTAATAGCGAAGAGGCCCGCACCGATCGCCCTTCCCAACAGTTGCGCA

GCCTGAATGGCGAATGGCGCCTGATGCGGTATTTTCTCCTTACGCATCTGTGCGGTATTTCACACCGCAT

ATGGTGCACTCTCAGTACAATCTGCTCTGATGCCGCATAGTTAAGCCAGCCCCGACACCCGCCAACACCC

GCTGACGCGCCCTGACGGGCTTGTCTGCTCCCGGCATCCGCTTACAGACAAGCTGTGACCGTCTCCGGGA

GCTGCATGTGTCAGAGGTTTTCACCGTCATCACCGAAACGCGCGA

No customer comments for the moment.

Add A Comment

Related Products

Cart  

No products

Total $0.00

Prices don't include postage.

Cart