pCVD442

$198.00

  • Model: PVT17741
  • 49 Units in Stock
Ask a question


Add to Cart:

pCVD442

pCVD442 Information

Product Name: pCVD442
Cat No.: PVT17741
Plasmid form: Freeze-dried powder
Storage Condition: -20℃
Bulk order Please contact us: sales@lifescience-market.com
Promoter: inquiry
Bacterial Resistance(s): Amp
Screening: inquiry
Growth Strain(s): SY327 lambda pir
Culture Medium: LB
Temperature: 37 Centigrade
Vector Size: 6345bp

 

pCVD442 Sequence

GAGGTTTTCACCGTCATCACCGAAACGCGCGAGGCAGCAAGGAGATGGCGCCCAACAGTCCCCCGGCCACGGGGCCTGCC
ACCATACCCACGCCGAAACAAGCGCTCATGAGCCCGAAGTGGCGAGCCCGATCTTCCCCATCGGTGATGTCGGCGATATA
GGCGCCAGCAACCGCACCTGTGGCGCCGGTGATGCCGGCCACGATGCGTCCGGCGTAGAGGATCCTTTTTGTCCGGTGTT
GGGTTGAAGGTGAAGCCGGTCGGGGCCGCAGCGGGGGCCGGCTTTTCAGCCTTGCCCCCCTGCTTCGGCCGCCGTGGCTC
CGGCGTCTTGGGTGCCGGCGCGGGTTCCGCAGCCTTGGCCTGCGGTGCGGGCACATCGGCGGGCTTGGCCTTGATGTGCC
GCCTGGCGTGCGAGCGGAACGTCTCGTAGGAGAACTTGACCTTCCCCGTTTCCCGCATGTGCTCCCAAATGGTGACGAGC
GCATAGCCGGACGCTAACGCCGCCTCGACATCCGCCCTCACCGCCAGGAACGCAACCGCAGCCTCATCACGCCGGCGCTT
CTTGGCCGCGCGGGATTCAACCCACTCGGCCAGCTCGTCGGTGTAGCTCTTTGGCATCGTCTCTCGCCTGTCCCCTCAGT
TCAGTAATTTCCTGCATTTGCCTGTTTCCAGTCGGTAGATATTCCACAAAACAGCAGGGAAGCAGCGCTTTTCCGCTGCA
TAACCCTGCTTCGGGGTCATTATAGCGATTTTTTCGGTATATCCATCCTTTTTCGCACGATATACAGGATTTTGCCAAAG
GGTTCGTGTAGACTTTCCTTGGTGTATCCAACGGCGTCAGCCGGGCAGGATAGGTGAAGTAGGCCCACCCGCGAGCGGGT
GTTCCTTCTTCACTGTCCCTTATTCGCACCTGGCGGTGCTCAACGGGAATCCTGCTCTGCGAGGCTGGCCGGCTACCGCC
GGCGTAACAGATGAGGGCAAGCGGATGGCTGATGAAACCAAGCCAACCAGGAAGGGCAGCCCACCTATCAAGGTGTACTG
CCTTCCAGACGAACGAAGAGCGATTGAGGAAAAGGCGGCGGCGGCCGGCATGAGCCTGTCGGCCTACCTGCTGGCCGTCG
GCCAGGGCTACAAAATCACGGGCGTCGTGGACTATGAGCACGTCCGCGAGCTGGCCCGCATCAATGGCGACCTGGGCCGC
CTGGGCGGCCTGCTGAAACTCTGGCTCACCGACGACCCGCGCACGGCGCGGTTCGGTGATGCCACGATCCTCGCCCTGCT
GGCGAAGATCGAAGAGAAGCAGGACGAGCTTGGCAAGGTCATGATGGGCGTGGTCCGCCCGAGGGCAGAGCCATGACTTT
TTTAGCCGCTAAAACGGCCGGGGGGTGCGCGTGATTGCCAAGCACGTCCCCATGCGCTCCATCAAGAAGAGCGACTTCGC
GGAGCTGGTGAAGTACATCACCGACGAGCAAGGCAAGACCGAGCGCCTGGGTCACGTGCGCGTCACGAACTGCGAGGCAA
ACACCCTGCCCGCTGTCATGGCCGAGGTGATGGCGACCCAGCACGGCAACACCCGTTCCGAGGCCGACAAGACCTATCAC
CTGCTGGTTAGCTTCCGCGCGGGAGAGAAGCCCGACGCGGAGACGTTGCGCGCGATTGAGGACCGCATCTGCGCTGGGCT
TGGCTTCGCCGAGCATCAGCGCGTCAGTGCCGTGCATCACGACACCGACAACCTGCACATCCATATCGCCATCAACAAGA
TTCACCCGACCCGAAACACCATCCATGAGCCGTATCGGGCCTACCGCGCCCTCGCTGACCTCTGCGCGACGCTCGAACGG
GACTACGGGCTTGAGCGTGACAATCACGAAACGCGGCAGCGCGTTTCCGAGAACCGCGCGAACGACATGGAGCGGCACGC
GGGCGTGGAAAGCCTGGTCGGCTGGATCCGGCCACGATGCGTCCGGCGTAGAGGATCTGAAGATCAGCAGTTCAACCTGT
TGATAGTACGTACTAAGCTCTCATGTTTCACGTACTAAGCTCTCATGTTTAACGTACTAAGCTCTCATGTTTAACGAACT
AAACCCTCATGGCTAACGTACTAAGCTCTCATGGCTAACGTACTAAGCTCTCATGTTTCACGTACTAAGCTCTCATGTTT
GAACAATAAAATTAATATAAATCAGCAACTTAAATAGCCTCTAAGGTTTTAAGTTTTATAAGAAAAAAAAGAATATATAA
GGCTTTTAAAGCTTTTAAGGTTTAACGGTTGTGGACAACAAGCCAGGGATGTAACGCACTGAGAAGCCCTTAGAGCCTCT
CAAAGCAATTTTGAGTGACACAGGAACACTTAACGGCTGACATGGGAATTCCACATGTGGAATTCCACATGTGGAATTGT
GAGCGGATAACAATTTGTGGAATTCCCGGGAGAGCTCGATATCGCATGCGGTACCTCTAGAAGAAGCTTGGGATCCGTCG
ACCTGCAGATCCGTCGACCTGCAGGTCGACTCTAGAGGATCGATCCTTTTTAACCCATCACATATACCTGCCGTTCACTA
TTATTTAGTGAAATGAGATATTATGATATTTTCTGAATTGTGATTAAAAAGGCAACTTTATGCCCATGCAACAGAAACTA
TAAAAAATACAGAGAATGAAAAGAAACAGATAGATTTTTTAGTTCTTTAGGCCCGTAGTCTGCAAATCCTTTTATGATTT
TCTATCAAACAAAAGAGGAAAATAGACCAGTTGCAATCCAAACGAGAGTCTAATAGAATGAGGTCGAAAAGTAAATCGCG
CGGGTTTGTTACTGATAAAGCAGGCAAGACCTAAAATGTGTAAAGGGCAAAGTGTATACTTTGGCGTCACCCCTTACATA
TTTTAGGTCTTTTTTTATTGTGCGTAACTAACTTGCCATCTTCAAACAGGAGGGCTGGAAGAAGCAGACCGCTAACACAG
TACATAAAAAAGGAGACATGAACGATGAACATCAAAAAGTTTGCAAAACAAGCAACAGTATTAACCTTTACTACCGCACT
GCTGGCAGGAGGCGCAACTCAAGCGTTTGCGAAAGAAACGAACCAAAAGCCATATAAGGAAACATACGGCATTTCCCATA
TTACACGCCATGATATGCTGCAAATCCCTGAACAGCAAAAAAATGAAAAATATCAAGTTCCTGAATTCGATTCGTCCACA
ATTAAAAATATCTCTTCTGCAAAAGGCCTGGACGTTTGGGACAGCTGGCCATTACAAAACGCTGACGGCACTGTCGCAAA
CTATCACGGCTACCACATCGTCTTTGCATTAGCCGGAGATCCTAAAAATGCGGATGACACATCGATTTACATGTTCTATC
AAAAAGTCGGCGAAACTTCTATTGACAGCTGGAAAAACGCTGGCCGCGTCTTTAAAGACAGCGACAAATTCGATGCAAAT
GATTCTATCCTAAAAGACCAAACACAAGAATGGTCAGGTTCAGCCACATTTACATCTGACGGAAAAATCCGTTTATTCTA
CACTGATTTCTCCGGTAAACATTACGGCAAACAAACACTGACAACTGCACAAGTTAACGTATCAGCATCAGACAGCTCTT
TGAACATCAACGGTGTAGAGGATTATAAATCAATCTTTGACGGTGACGGAAAAACGTATCAAAATGTACAGCAGTTCATC
GATGAAGGCAACTACAGCTCAGGCGACAACCATACGCTGAGAGATCCTCACTACGTAGAAGATAAAGGCCACAAATACTT
AGTATTTGAAGCAAACACTGGAACTGAAGATGGCTACCAAGGCGAAGAATCTTTATTTAACAAAGCATACTATGGCAAAA
GCACATCATTCTTCCGTCAAGAAAGTCAAAAACTTCTGCAAAGCGATAAAAAACGCACGGCTGAGTTAGCAAACGGCGCT
CTCGGTATGATTGAGCTAAACGATGATTACACACTGAAAAAAGTGATGAAACCGCTGATTGCATCTAACACAGTAACAGA
TGAAATTGAACGCGCGAACGTCTTTAAAATGAACGGCAAATGGTACCTGTTCACTGACTCCCGCGGATCAAAAATGACGA
TTGACGGCATTACGTCTAACGATATTTACATGCTTGGTTATGTTTCTAATTCTTTAACTGGCCCATACAAGCCGCTGAAC
AAAACTGGCCTTGTGTTAAAAATGGATCTTGATCCTAACGATGTAACCTTTACTTACTCACACTTCGCTGTACCTCAAGC
GAAAGGAAACAATGTCGTGATTACAAGCTATATGACAAACAGAGGATTCTACGCAGACAAACAATCAACGTTTGCGCCAA
GCTTCCTGCTGAACATCAAAGGCAAGAAAACATCTGTTGTCAAAGACAGCATCCTTGAACAAGGACAATTAACAGTTAAC
AAATAAAAACGCAAAAGAAAATGCCGATATCCTATTGGCATTTTCTTTTATTTCTTATCAACATAAAGGTGAATCCCATA
TGAACTATATAAAAGCAGGCAAATGGCTAACCGTATTCCTAACCTTTTGGTAATGACTCCAACTTATTGATAGTGTTTTA
TGTTCAGATAATGCCCGATGACTTTGTCATGCAGCTCCACCGATTTTGAGAACGACAGCGACTTCCGTCCCAGCCGTGCC
AGGTGCTGCCTCAGATTCAGGTTATGCCGCTCAATTCGCTGCGTATATCGCTTGCTGATTACGTGCAGCTTTCCCTTCAG
GCGGGATTCATACAGCGGCCAGCCATCCGTCATCCATATCACCACGTCAAAGGGTGACAGCAGGCTCATAAGACGCCCCA
GCGTCGCCATAGTGCGTTCACCGAATACGTGCGCAACAACCGTCTTCCGGAGACTGTCATACGCGTAAAACAGCCAGCGC
TGGCGCGATTTAGCCCCGACATAGCCCCACTGTTCGTCCATTTCCGCGCAGACGATGACGTCACTGCCCGGCTGTATGCG
CGAGGTTACCGACTGCGGCCTGAGTTTTTTAAGTGACGTAAAATCGTGTTGAGGCCAACGCCCATAATGCGGGCTGTTGC
CCGGCATCCAACGCCATTCATGGCCATATCAATGATTTTCTGGTGCGTACCGGGTTGAGAAGCGGTGTAAGTGAACTGCA
GGTGGCACTTTTCGGGGAAATGTGCGCGGAACCCCTATTTGTTTATTTTTCTAAATACATTCAAATATGTATCCGCTCAT
GAGACAATAACCCTGATAAATGCTTCAATAATATTGAAAAAGGAAGAGTATGAGTATTCAACATTTCCGTGTCGCCCTTA
TTCCCTTTTTTGCGGCATTTTGCCTTCCTGTTTTTGCTCACCCAGAAACGCTGGTGAAAGTAAAAGATGCTGAAGATCAG
TTGGGTGCACGAGTGGGTTACATCGAACTGGATCTCAACAGCGGTAAGATCCTTGAGAGTTTTCGCCCCGAAGAACGTTT
TCCAATGATGAGCACTTTTAAAGTTCTGCTATGTGGCGCGGTATTATCCCGTGTTGACGCCGGGCAAGAGCAACTCGGTC
GCCGCATACACTATTCTCAGAATGACTTGGTTGAGTACTCACCAGTCACAGAAAAGCATCTTACGGATGGCATGACAGTA
AGAGAATTATGCAGTGCTGCCATAACCATGAGTGATAACACTGCGGCCAACTTACTTCTGACAACGATCGGAGGACCGAA
GGAGCTAACCGCTTTTTTGCACAACATGGGGGATCATGTAACTCGCCTTGATCGTTGGGAACCGGAGCTGAATGAAGCCA
TACCAAACGACGAGCGTGACACCACGATGCCTGCAGCAATGGCAACAACGTTGCGCAAACTATTAACTGGCGAACTACTT
ACTCTAGCTTCCCGGCAACAATTAATAGACTGGATGGAGGCGGATAAAGTTGCAGGACCACTTCTGCGCTCGGCCCTTCC
GGCTGGCTGGTTTATTGCTGATAAATCTGGAGCCGGTGAGCGTGGGTCTCGCGGTATCATTGCAGCACTGGGGCCAGATG
GTAAGCCCTCCCGTATCGTAGTTATCTACACGACGGGGAGTCAGGCAACTATGGATGAACGAAATAGACAGATCGCTGAG
ATAGGTGCCTCACTGATTAAGCATTGGTAACTGTCAGACCAAGTTTACTCATATATACTTTAGATTGATTTATGGTGCAC
TCTCAGTACAATCTGCTCTGATGCCGCATAGTTAAGCCAGTATACACTCCGCTATCGCTACGTGACTGGGTCATGGCTGC
GCCCCGACACCCGCCAACACCCGCTGACGCGCCCTGACGGGCTTGTCTGCTCCCGGCATCCGCTTACAGACAAGCTGTGA
CCGTCTCCGGGAGCTGCATGTGTCA
//
 

Caution:
Product is for research use only!

 

Alternative Name: pCVD442,pCVD442 vector,pCVD442 plasmid,pCVD442 map,pCVD442 sequence

No customer comments for the moment.

Add A Comment

Related Products

Cart  

No products

Total $0.00

Prices don't include postage.

Cart