
  • Model: PVT11171
  • 50 Units in Stock
Ask a question

Add to Cart:


Catalog No. PVT11171
Packing 2ug


pCXSN Information

Function plant expression plasmid

Promoter: CaMV 35S promoter

Replicator: pUC ori, pVS1 oriV

Terminator: NOS Terminator

Plasmid classification: plant series plasmids; plant expression plasmids; other series of plasmids

Plasmid size: 10802bp

Plasmid label: ccdB lethal gene

Prokaryotic resistance: kanamycin Kan

Screening markers: hygromycin Hyg

Cloned strains of Escherichia coli, Stbl3 and other Escherichia coli

Culture conditions: 37 centigrade, aerobic, LB

Expressing the host: plant

Induction mode: no induction, constituent expression

3'sequencing primers: NOS-ter:cccatctcataaataacgtc


pCXSN Description

PCXSN is a plant overexpression vector, which is transformed into T vector after Xcm I digestion, and can be transformed directly into the gene.



pCXSN Reference

A versatile zero background T-vector system for gene cloning and functional genomics.
Plant Physiol. 2009 Jul;150(3):1111-21. doi: 10.1104/pp.109.137125. Epub 2009 Apr 29.
Chen S1, Songkumarn P, Liu J, Wang GL.


pCXSN Sequence

LOCUS       Exported               10802 bp ds-DNA     circular SYN 25-AUG-2017

DEFINITION  synthetic circular DNA


SOURCE      synthetic DNA construct

  ORGANISM  synthetic DNA construct

REFERENCE   1  (bases 1 to 10802)

  TITLE     Direct Submission

  JOURNAL   Exported Aug 25, 2017

FEATURES             Location/Qualifiers

     source          1..10802

                     /organism="synthetic DNA construct"

                     /mol_type="other DNA"

     terminator      8..260

                     /label=NOS terminator

                     /note="nopaline synthase terminator and poly(A) signal"

     primer_bind     119..138


     CDS             627..932



                     /product="CcdB, a bacterial toxin that poisons DNA gyrase"


                     /note="Plasmids containing the ccdB gene cannot be 

                     propagated in standard E. coli strains."



     promoter        complement(1002..1892)

                     /label=CaMV 35S promoter

                     /note="strong constitutive promoter from cauliflower mosaic


     misc_feature    2126..2150

                     /label=RB T-DNA repeat

                     /note="right border repeat from nopaline C58 T-DNA"

     CDS             3449..4078


                     /product="stability protein from the Pseudomonas plasmid 

                     pVS1 (Heeb et al., 2000)"

                     /label=pVS1 StaA





     CDS             4512..5579


                     /product="replication protein from the Pseudomonas plasmid 

                     pVS1 (Heeb et al., 2000)"

                     /label=pVS1 RepA








     rep_origin      5645..5839

                     /label=pVS1 oriV

                     /note="origin of replication for the Pseudomonas plasmid 

                     pVS1 (Heeb et al., 2000)"

     misc_feature    6183..6323


                     /note="basis of mobility region from pBR322"

     rep_origin      complement(6509..7097)


                     /label=pUC ori

                     /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of 


     CDS             complement(7184..7978)



                     /product="aminoglycoside phosphotransferase"


                     /note="confers resistance to kanamycin"






     misc_feature    8403..8427

                     /label=LB T-DNA repeat

                     /note="left border repeat from nopaline C58 T-DNA"

     polyA_signal    8505..8679

                     /label=CaMV poly(A) signal

                     /note="cauliflower mosaic virus polyadenylation signal"

     CDS             complement(8719..9744)



                     /product="aminoglycoside phosphotransferase from E. coli"


                     /note="confers resistance to hygromycin"








     promoter        complement(9811..10488)

                     /label=CaMV 35S promoter (enhanced)

                     /note="cauliflower mosaic virus 35S promoter with a 

                     duplicated enhancer region"


        1 gaattccgat ctagtaacat agatgacacc gcgcgcgata atttatccta gtttgcgcgc

       61 tatattttgt tttctatcgc gtattaaatg tataattgcg ggactctaat cataaaaacc

      121 catctcataa ataacgtcat gcattacatg ttaattatta catgcttaac gtaattcaac

      181 agaaattata tgataatcat cgcaagaccg gcaacaggat tcaatcttaa gaaactttat

      241 tgccaaatgt ttgaacgatc ggggaaattc gctagtggat ccccaatact tgtatggggc

      301 ttactaaaag ccagataaca gtatgcgtat ttgcgcgctg atttttgcgg tataagaata

      361 tatactgata tgtatacccg aagtatgtca aaaagaggta tgctatgaag cagcgtatta

      421 cagtgacagt tgacagcgac agctatcagt tgctcaaggc atatatgatg tcaatatctc

      481 cggtctggta agcacaacca tgcagaatga agcccgtcgt ctgcgtgccg aacgctggaa

      541 agcggaaaat caggaaggga tggctgaggt cgcccggttt attgaaatga acggctcttt

      601 tgctgacgag aacaggggct ggtgaaatgc agtttaaggt ttacacctat aaaagagaga

      661 gccgttatcg tctgtttgtg gatgtacaga gtgatattat tgacacgccc gggcgacgga

      721 tggtgatccc cctggccagt gcacgtctgc tgtcagataa agtctcccgt gaactttacc

      781 cggtggtgca tatcggggat gaaagctggc gcatgatgac caccgatatg gccagtgtgc

      841 cggtctccgt tatcggggaa gaagtggctg atctcagcca ccgcgaaaat gacatcaaaa

      901 acgccattaa cctgatgttc tggggaatat aaatgtcagg ctcccttata cacagccagt

      961 ctgcaggtcg acccatacaa gtattgggga tccccctcga gtatcgttcg taaatggtga

     1021 aaattttcag aaaattgctt ttgctttaaa agaaatgatt taaattgctg caatagaagt

     1081 agaatgcttg attgcttgag attcgtttgt tttgtatatg ttgtgttgag gtcgaggtcc

     1141 tctccaaatg aaatgaactt ccttatatag aggaagggtc ttgcgaagga tagtgggatt

     1201 gtgcgtcatc ccttacgtca gtggagatat cacatcaatc cacttgcttt gaagacgtgg

     1261 ttggaacgtc ttctttttcc acgatgctcc tcgtgggtgg gggtccatct ttgggaccac

     1321 tgtcggcaga ggcatcttca acgatggcct ttcctttatc gcaatgatgg catttgtagg

     1381 agccaccttc cttttccact atcttcacaa taaagtgaca gatagctggg caatggaatc

     1441 cgaggaggtt tccggatatt accctttgtt gaaaagtctc aattgccctt tggtcttctg

     1501 agactgtatc tttgatattt ttggagtaga caagtgtgtc gtgctccacc atgttatcac

     1561 atcaatccac ttgctttgaa gacgtggttg gaacgtcttc tttttccacg atgctcctcg

     1621 tgggtggggg tccatctttg ggaccactgt cggcagaggc atcttcaacg atggcctttc

     1681 ctttatcgca atgatggcat ttgtaggagc caccttcctt ttccactatc ttcacaataa

     1741 agtgacagat agctgggcaa tggaatccga ggaggtttcc ggatattacc ctttgttgaa

     1801 aagtctcaat tgccctttgg tcttctgaga ctgtatcttt gatatttttg gagtagacaa

     1861 gtgtgtcgtg ctccaccatg ttgacctgca ggcatgcaag cttggcactg gccgtcgttt

     1921 tacaacgtcg tgactgggaa aaccctggcg ttacccaact taatcgcctt gcagcacatc

     1981 cccctttcgc cagctggcgt aatagcgaag aggcccgcac cgatcgccct tcccaacagt

     2041 tgcgcagcct gaatggcgaa tgctagagca gcttgagctt ggatcagatt gtcgtttccc

     2101 gccttcagtt taaactatca gtgtttgaca ggatatattg gcgggtaaac ctaagagaaa

     2161 agagcgttta ttagaataac ggatatttaa aagggcgtga aaaggtttat ccgttcgtcc

     2221 atttgtatgt gcatgccaac cacagggttc ccctcgggat caaagtactt tgatccaacc

     2281 cctccgctgc tatagtgcag tcggcttctg acgttcagtg cagccgtctt ctgaaaacga

     2341 catgtcgcac aagtcctaag ttacgcgaca ggctgccgcc ctgccctttt cctggcgttt

     2401 tcttgtcgcg tgttttagtc gcataaagta gaatacttgc gactagaacc ggagacatta

     2461 cgccatgaac aagagcgccg ccgctggcct gctgggctat gcccgcgtca gcaccgacga

     2521 ccaggacttg accaaccaac gggccgaact gcacgcggcc ggctgcacca agctgttttc

     2581 cgagaagatc accggcacca ggcgcgaccg cccggagctg gccaggatgc ttgaccacct

     2641 agccctggcg acgttgtgac agtgaccagg ctagaccgcc tggcccgcag cacccgcgac

     2701 ctactggaca ttgccgagcg catccaggag gccggcgcgg gcctgcgtag cctggcagag

     2761 ccgtgggccg acaccaccac gccggccggc cgcatggtgt tgaccgtgtt cgccggcatt

     2821 gccgagttcg agcgttccct aatcatcgac cgcacccgga gcgggcgcga ggccgccaag

     2881 gcccgaggcg tgaagtttgg cccccgccct accctcaccc cggcacagat cgcgcacgcc

     2941 cgcgagctga tcgaccagga aggccgcacc gtgaaagagg cggctgcact gcttggcgtg

     3001 catcgctcga ccctgtaccg cgcacttgag cgcagcgagg aagtgacgcc caccgaggcc

     3061 aggcggcgcg gtgccttccg tgaggacgca ttgaccgagg ccgacgccct ggcggccgcc

     3121 gagaatgaac gccaagagga acaagcatga aaccgcacca ggacggccag gacgaaccgt

     3181 ttttcattac cgaagagatc gaggcggaga tgatcgcggc cgggtacgtg ttcgagccgc

     3241 ccgcgcacgt ctcaaccgtg cggctgcatg aaatcctggc cggtttgtct gatgccaagc

     3301 tggcggcctg gccggccagc ttggccgctg aagaaaccga gcgccgccgt ctaaaaaggt

     3361 gatgtgtatt tgagtaaaac agcttgcgtc atgcggtcgc tgcgtatatg atgcgatgag

     3421 taaataaaca aatacgcaag gggaacgcat gaaggttatc gctgtactta accagaaagg

     3481 cgggtcaggc aagacgacca tcgcaaccca tctagcccgc gccctgcaac tcgccggggc

     3541 cgatgttctg ttagtcgatt ccgatcccca gggcagtgcc cgcgattggg cggccgtgcg

     3601 ggaagatcaa ccgctaaccg ttgtcggcat cgaccgcccg acgattgacc gcgacgtgaa

     3661 ggccatcggc cggcgcgact tcgtagtgat cgacggagcg ccccaggcgg cggacttggc

     3721 tgtgtccgcg atcaaggcag ccgacttcgt gctgattccg gtgcagccaa gcccttacga

     3781 catatgggcc accgccgacc tggtggagct ggttaagcag cgcattgagg tcacggatgg

     3841 aaggctacaa gcggcctttg tcgtgtcgcg ggcgatcaaa ggcacgcgca tcggcggtga

     3901 ggttgccgag gcgctggccg ggtacgagct gcccattctt gagtcccgta tcacgcagcg

     3961 cgtgagctac ccaggcactg ccgccgccgg cacaaccgtt cttgaatcag aacccgaggg

     4021 cgacgctgcc cgcgaggtcc aggcgctggc cgctgaaatt aaatcaaaac tcatttgagt

     4081 taatgaggta aagagaaaat gagcaaaagc acaaacacgc taagtgccgg ccgtccgagc

     4141 gcacgcagca gcaaggctgc aacgttggcc agcctggcag acacgccagc catgaagcgg

     4201 gtcaactttc agttgccggc ggaggatcac accaagctga agatgtacgc ggtacgccaa

     4261 ggcaagacca ttaccgagct gctatctgaa tacatcgcgc agctaccaga gtaaatgagc

     4321 aaatgaataa atgagtagat gaattttagc ggctaaagga ggcggcatgg aaaatcaaga

     4381 acaaccaggc accgacgccg tggaatgccc catgtgtgga ggaacgggcg gttggccagg

     4441 cgtaagcggc tgggttgtct gccggccctg caatggcact ggaaccccca agcccgagga

     4501 atcggcgtga cggtcgcaaa ccatccggcc cggtacaaat cggcgcggcg ctgggtgatg

     4561 acctggtgga gaagttgaag gccgcgcagg ccgcccagcg gcaacgcatc gaggcagaag

     4621 cacgccccgg tgaatcgtgg caagcggccg ctgatcgaat ccgcaaagaa tcccggcaac

     4681 cgccggcagc cggtgcgccg tcgattagga agccgcccaa gggcgacgag caaccagatt

     4741 ttttcgttcc gatgctctat gacgtgggca cccgcgatag tcgcagcatc atggacgtgg

     4801 ccgttttccg tctgtcgaag cgtgaccgac gagctggcga ggtgatccgc tacgagcttc

     4861 cagacgggca cgtagaggtt tccgcagggc cggccggcat ggccagtgtg tgggattacg

     4921 acctggtact gatggcggtt tcccatctaa ccgaatccat gaaccgatac cgggaaggga

     4981 agggagacaa gcccggccgc gtgttccgtc cacacgttgc ggacgtactc aagttctgcc

     5041 ggcgagccga tggcggaaag cagaaagacg acctggtaga aacctgcatt cggttaaaca

     5101 ccacgcacgt tgccatgcag cgtacgaaga aggccaagaa cggccgcctg gtgacggtat

     5161 ccgagggtga agccttgatt agccgctaca agatcgtaaa gagcgaaacc gggcggccgg

     5221 agtacatcga gatcgagcta gctgattgga tgtaccgcga gatcacagaa ggcaagaacc

     5281 cggacgtgct gacggttcac cccgattact ttttgatcga tcccggcatc ggccgttttc

     5341 tctaccgcct ggcacgccgc gccgcaggca aggcagaagc cagatggttg ttcaagacga

     5401 tctacgaacg cagtggcagc gccggagagt tcaagaagtt ctgtttcacc gtgcgcaagc

     5461 tgatcgggtc aaatgacctg ccggagtacg atttgaagga ggaggcgggg caggctggcc

     5521 cgatcctagt catgcgctac cgcaacctga tcgagggcga agcatccgcc ggttcctaat

     5581 gtacggagca gatgctaggg caaattgccc tagcagggga aaaaggtcga aaaggtctct

     5641 ttcctgtgga tagcacgtac attgggaacc caaagccgta cattgggaac cggaacccgt

     5701 acattgggaa cccaaagccg tacattggga accggtcaca catgtaagtg actgatataa

     5761 aagagaaaaa aggcgatttt tccgcctaaa actctttaaa acttattaaa actcttaaaa

     5821 cccgcctggc ctgtgcataa ctgtctggcc agcgcacagc cgaagagctg caaaaagcgc

     5881 ctacccttcg gtcgctgcgc tccctacgcc ccgccgcttc gcgtcggcct atcgcggccg

     5941 ctggccgctc aaaaatggct ggcctacggc caggcaatct accagggcgc ggacaagccg

     6001 cgccgtcgcc actcgaccgc cggcgcccac atcaaggcac cctgcctcgc gcgtttcggt

     6061 gatgacggtg aaaacctctg acacatgcag ctcccggaga cggtcacagc ttgtctgtaa

     6121 gcggatgccg ggagcagaca agcccgtcag ggcgcgtcag cgggtgttgg cgggtgtcgg

     6181 ggcgcagcca tgacccagtc acgtagcgat agcggagtgt atactggctt aactatgcgg

     6241 catcagagca gattgtactg agagtgcacc atatgcggtg tgaaataccg cacagatgcg

     6301 taaggagaaa ataccgcatc aggcgctctt ccgcttcctc gctcactgac tcgctgcgct

     6361 cggtcgttcg gctgcggcga gcggtatcag ctcactcaaa ggcggtaata cggttatcca

     6421 cagaatcagg ggataacgca ggaaagaaca tgtgagcaaa aggccagcaa aaggccagga

     6481 accgtaaaaa ggccgcgttg ctggcgtttt tccataggct ccgcccccct gacgagcatc

     6541 acaaaaatcg acgctcaagt cagaggtggc gaaacccgac aggactataa agataccagg

     6601 cgtttccccc tggaagctcc ctcgtgcgct ctcctgttcc gaccctgccg cttaccggat

     6661 acctgtccgc ctttctccct tcgggaagcg tggcgctttc tcatagctca cgctgtaggt

     6721 atctcagttc ggtgtaggtc gttcgctcca agctgggctg tgtgcacgaa ccccccgttc

     6781 agcccgaccg ctgcgcctta tccggtaact atcgtcttga gtccaacccg gtaagacacg

     6841 acttatcgcc actggcagca gccactggta acaggattag cagagcgagg tatgtaggcg

     6901 gtgctacaga gttcttgaag tggtggccta actacggcta cactagaagg acagtatttg

     6961 gtatctgcgc tctgctgaag ccagttacct tcggaaaaag agttggtagc tcttgatccg

     7021 gcaaacaaac caccgctggt agcggtggtt tttttgtttg caagcagcag attacgcgca

     7081 gaaaaaaagg atctcaagaa gatcctttga tcttttctac ggggtctgac gctcagtgga

     7141 acgaaaactc acgttaaggg attttggtca tgcattctag gtactaaaac aattcatcca

     7201 gtaaaatata atattttatt ttctcccaat caggcttgat ccccagtaag tcaaaaaata

     7261 gctcgacata ctgttcttcc ccgatatcct ccctgatcga ccggacgcag aaggcaatgt

     7321 cataccactt gtccgccctg ccgcttctcc caagatcaat aaagccactt actttgccat

     7381 ctttcacaaa gatgttgctg tctcccaggt cgccgtggga aaagacaagt tcctcttcgg

     7441 gcttttccgt ctttaaaaaa tcatacagct cgcgcggatc tttaaatgga gtgtcttctt

     7501 cccagttttc gcaatccaca tcggccagat cgttattcag taagtaatcc aattcggcta

     7561 agcggctgtc taagctattc gtatagggac aatccgatat gtcgatggag tgaaagagcc

     7621 tgatgcactc cgcatacagc tcgataatct tttcagggct ttgttcatct tcatactctt

     7681 ccgagcaaag gacgccatcg gcctcactca tgagcagatt gctccagcca tcatgccgtt

     7741 caaagtgcag gacctttgga acaggcagct ttccttccag ccatagcatc atgtcctttt

     7801 cccgttccac atcataggtg gtccctttat accggctgtc cgtcattttt aaatataggt

     7861 tttcattttc tcccaccagc ttatatacct tagcaggaga cattccttcc gtatctttta

     7921 cgcagcggta tttttcgatc agttttttca attccggtga tattctcatt ttagccattt

     7981 attatttcct tcctcttttc tacagtattt aaagataccc caagaagcta attataacaa

     8041 gacgaactcc aattcactgt tccttgcatt ctaaaacctt aaataccaga aaacagcttt

     8101 ttcaaagttg ttttcaaagt tggcgtataa catagtatcg acggagccga ttttgaaacc

     8161 gcggtgatca caggcagcaa cgctctgtca tcgttacaat caacatgcta ccctccgcga

     8221 gatcatccgt gtttcaaacc cggcagctta gttgccgttc ttccgaatag catcggtaac

     8281 atgagcaaag tctgccgcct tacaacggct ctcccgctga cgccgtcccg gactgatggg

     8341 ctgcctgtat cgagtggtga ttttgtgccg agctgccggt cggggagctg ttggctggct

     8401 ggtggcagga tatattgtgg tgtaaacaaa ttgacgctta gacaacttaa taacacattg

     8461 cggacgtttt taatgtactg aattaacgcc gaattaattc gggggatctg gattttagta

     8521 ctggattttg gttttaggaa ttagaaattt tattgataga agtattttac aaatacaaat

     8581 acatactaag ggtttcttat atgctcaaca catgagcgaa accctatagg aaccctaatt

     8641 cccttatctg ggaactactc acacattatt atggagaaac tcgagcttgt cgatcgacag

     8701 atccggtcgg catctactct atttctttgc cctcggacga gtgctggggc gtcggtttcc

     8761 actatcggcg agtacttcta cacagccatc ggtccagacg gccgcgcttc tgcgggcgat

     8821 ttgtgtacgc ccgacagtcc cggctccgga tcggacgatt gcgtcgcatc gaccctgcgc

     8881 ccaagctgca tcatcgaaat tgccgtcaac caagctctga tagagttggt caagaccaat

     8941 gcggagcata tacgcccgga gtcgtggcga tcctgcaagc tccggatgcc tccgctcgaa

     9001 gtagcgcgtc tgctgctcca tacaagccaa ccacggcctc cagaagaaga tgttggcgac

     9061 ctcgtattgg gaatccccga acatcgcctc gctccagtca atgaccgctg ttatgcggcc

     9121 attgtccgtc aggacattgt tggagccgaa atccgcgtgc acgaggtgcc ggacttcggg

     9181 gcagtcctcg gcccaaagca tcagctcatc gagagcctgc gcgacggacg cactgacggt

     9241 gtcgtccatc acagtttgcc agtgatacac atggggatca gcaatcgcgc atatgaaatc

     9301 acgccatgta gtgtattgac cgattccttg cggtccgaat gggccgaacc cgctcgtctg

     9361 gctaagatcg gccgcagcga tcgcatccat agcctccgcg accggttgta gaacagcggg

     9421 cagttcggtt tcaggcaggt cttgcaacgt gacaccctgt gcacggcggg agatgcaata

     9481 ggtcaggctc tcgctaaact ccccaatgtc aagcacttcc ggaatcggga gcgcggccga

     9541 tgcaaagtgc cgataaacat aacgatcttt gtagaaacca tcggcgcagc tatttacccg

     9601 caggacatat ccacgccctc ctacatcgaa gctgaaagca cgagattctt cgccctccga

     9661 gagctgcatc aggtcggaga cgctgtcgaa cttttcgatc agaaacttct cgacagacgt

     9721 cgcggtgagt tcaggctttt tcatatctca ttgccccccg gatctgcgaa agctcgagag

     9781 agatagattt gtagagagag actggtgatt tcagcgtgtc ctctccaaat gaaatgaact

     9841 tccttatata gaggaaggtc ttgcgaagga tagtgggatt gtgcgtcatc ccttacgtca

     9901 gtggagatat cacatcaatc cacttgcttt gaagacgtgg ttggaacgtc ttctttttcc

     9961 acgatgctcc tcgtgggtgg gggtccatct ttgggaccac tgtcggcaga ggcatcttga

    10021 acgatagcct ttcctttatc gcaatgatgg catttgtagg tgccaccttc cttttctact

    10081 gtccttttga tgaagtgaca gatagctggg caatggaatc cgaggaggtt tcccgatatt

    10141 accctttgtt gaaaagtctc aatagccctt tggtcttctg agactgtatc tttgatattc

    10201 ttggagtaga cgagagtgtc gtgctccacc atgttatcac atcaatccac ttgctttgaa

    10261 gacgtggttg gaacgtcttc tttttccacg atgctcctcg tgggtggggg tccatctttg

    10321 ggaccactgt cggcagaggc atcttgaacg atagcctttc ctttatcgca atgatggcat

    10381 ttgtaggtgc caccttcctt ttctactgtc cttttgatga agtgacagat agctgggcaa

    10441 tggaatccga ggaggtttcc cgatattacc ctttgttgaa aagtctcaat agccctttgg

    10501 tcttctgaga ctgtatcttt gatattcttg gagtagacga gagtgtcgtg ctccaccatg

    10561 ttggcaagct gctctagcca atacgcaaac cgcctctccc cgcgcgttgg ccgattcatt

    10621 aatgcagctg gcacgacagg tttcccgact ggaaagcggg cagtgagcgc aacgcaatta

    10681 atgtgagtta gctcactcat taggcacccc aggctttaca ctttatgctt ccggctcgta

    10741 tgttgtgtgg aattgtgagc ggataacaat ttcacacagg aaacagctat gaccatgatt

    10801 ac



Product is for research use only!

No customer comments for the moment.

Add A Comment

Related Products


No products

Total $0.00

Prices don't include postage.
