
  • Model: PVT11171
  • 50 Units in Stock
Ask a question

Add to Cart:


Catalog No. PVT11171
Packing 2ug


pCXSN Information

Function plant expression plasmid

Promoter: CaMV 35S promoter

Replicator: pUC ori, pVS1 oriV

Terminator: NOS Terminator

Plasmid classification: plant series plasmids; plant expression plasmids; other series of plasmids

Plasmid size: 10802bp

Plasmid label: ccdB lethal gene

Prokaryotic resistance: kanamycin Kan

Screening markers: hygromycin Hyg

Cloned strains of Escherichia coli, Stbl3 and other Escherichia coli

Culture conditions: 37 centigrade, aerobic, LB

Expressing the host: plant

Induction mode: no induction, constituent expression

3'sequencing primers: NOS-ter:cccatctcataaataacgtc


pCXSN Description

PCXSN is a plant overexpression vector, which is transformed into T vector after Xcm I digestion, and can be transformed directly into the gene.



pCXSN Reference

A versatile zero background T-vector system for gene cloning and functional genomics.
Plant Physiol. 2009 Jul;150(3):1111-21. doi: 10.1104/pp.109.137125. Epub 2009 Apr 29.
Chen S1, Songkumarn P, Liu J, Wang GL.


pCXSN Sequence

LOCUS       Exported               10802 bp ds-DNA     circular SYN 25-AUG-2017
DEFINITION  synthetic circular DNA
SOURCE      synthetic DNA construct
  ORGANISM  synthetic DNA construct
REFERENCE   1  (bases 1 to 10802)
  TITLE     Direct Submission
  JOURNAL   Exported Aug 25, 2017 
FEATURES             Location/Qualifiers
     source          1..10802
                     /organism="synthetic DNA construct"
                     /mol_type="other DNA"
     terminator      8..260
                     /label=NOS terminator
                     /note="nopaline synthase terminator and poly(A) signal"
     primer_bind     119..138
     CDS             627..932
                     /product="CcdB, a bacterial toxin that poisons DNA gyrase"
                     /note="Plasmids containing the ccdB gene cannot be 
                     propagated in standard E. coli strains."
     promoter        complement(1002..1892)
                     /label=CaMV 35S promoter
                     /note="strong constitutive promoter from cauliflower mosaic
     misc_feature    2126..2150
                     /label=RB T-DNA repeat
                     /note="right border repeat from nopaline C58 T-DNA"
     CDS             3449..4078
                     /product="stability protein from the Pseudomonas plasmid 
                     pVS1 (Heeb et al., 2000)"
                     /label=pVS1 StaA
     CDS             4512..5579
                     /product="replication protein from the Pseudomonas plasmid 
                     pVS1 (Heeb et al., 2000)"
                     /label=pVS1 RepA
     rep_origin      5645..5839
                     /label=pVS1 oriV
                     /note="origin of replication for the Pseudomonas plasmid 
                     pVS1 (Heeb et al., 2000)"
     misc_feature    6183..6323
                     /note="basis of mobility region from pBR322"
     rep_origin      complement(6509..7097)
                     /label=pUC ori
                     /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of 
     CDS             complement(7184..7978)
                     /product="aminoglycoside phosphotransferase"
                     /note="confers resistance to kanamycin"
     misc_feature    8403..8427
                     /label=LB T-DNA repeat
                     /note="left border repeat from nopaline C58 T-DNA"
     polyA_signal    8505..8679
                     /label=CaMV poly(A) signal
                     /note="cauliflower mosaic virus polyadenylation signal"
     CDS             complement(8719..9744)
                     /product="aminoglycoside phosphotransferase from E. coli"
                     /note="confers resistance to hygromycin"
     promoter        complement(9811..10488)
                     /label=CaMV 35S promoter (enhanced)
                     /note="cauliflower mosaic virus 35S promoter with a 
                     duplicated enhancer region"
        1 gaattccgat ctagtaacat agatgacacc gcgcgcgata atttatccta gtttg
No customer comments for the moment.

Add A Comment

Related Products


No products

Total $0.00

Prices don't include postage.
