pDG364

$260.00

  • Model: PVT11304
  • 50 Units in Stock
Ask a question


Add to Cart:

pDG364


Catalog No. PVT11304
Packing 2ug

 

pDG364 Information

Plasmid size: 6257bp

Prokaryotic resistance: ampicillin Amp

Screening markers: chloramphenicol Chl

Cloned strain: Escherichia coli Stbl3

Culture conditions: 37 centigrade, aerobic, LB

 

pDG364 Reference

pDG364-paper

 

pDG364 Sequence

ATATCCCACTTTATCCAATTTTCGTTTGTTGAACTAATGGGTGCTTTAGTTGAAGAATAAAAGACCACATTAAAAAATGT
GGTCTTTTGTGTTTTTTAAAGGATTTGAGCGTAGCGAAAAATCCTTTTCTTTCTTATCTTGATAATAAGGGTAACTATTG
CCGATGATAAGCTGTCAAACATGAGAATTCGATAAGCTTCTAGGATCCTGAGCGCCGGTCGCTACCATTACCAGTTGGTC
TGGTGTCAAAAATAATAATAACCGGGCAGGCCATGTCTGCCCGTATTTCGCGTAAGGAAATCCATTATGTACTATTTAAT
TCTGCGTGACATCCCATCGATCAGACCAGTTTTTAATTTGTGTGTTTCCATGTGTCCAGTTTGGAATACTCTTAACCTCA
TTGGAAATCGCGGCATAATCACTGGTGGTATGATTGATGACCGCGTCAACAATGACCTTTATGCCATATTCTTCAGCGGC
TGCACACATTTCTTTAAATTCTTGTTCAGTACCTAAGTAACGGTTGCCAATTTGATACGATGTCGGCTGATACAGCCAGT
ACCAGTTCGACATGCTTTTATCTCCTTGATTCCCTTCCTTTACTTGGTTAATCGGAGATGTCTGAATGGCTGTATATCCT
GCATCATGAATATCCTTCATATTGTGTTTTAACGTATTGAACGACCAATTCCATGCATGAAGAATGGTTCCGCTTTTGAT
CGACGGTGCTGTAAGCTCATTCGATTTGTTCGCCGTTTCAGCACTCGCAGCCGCCGGTCCTGCCAGAACCAAATGAAACA
GCAATAAAAATCCAGCGAATAACGGCAGTAAAGAGGTTTTGAATCGTTTTGCAAACATTCTTGACACTCCTTATTTGATT
TTTTGAAGACTTACTTCGGAGTCAAAAATCCCTCTTACTTCATTCTTCCGCTTCCTCCTTTCAAACCGATGTGAAGACTG
GAGAATTTTGTTAATTCTTGAAGACGAAAGGGCCTCGTGATACGCCTATTTTTATAGGTTAATGTCATGATAATAATGGT
TTCTTAGACGTCAGGTGGCACTTTTCGGGGAAATGTGCGCGGAACCCCTATTTGTTTATTTTTCTAAATACATTCAAATA
TGTATCCGCTCATGAGACAATAACCCTGATAAATGCTTCAATAATATTGAAAAAGGAAGAGTATGAGTATTCAACATTTC
CGTGTCGCCCTTATTCCCTTTTTTGCGGCATTTTGCCTTCCTGTTTTTGCTCACCCAGAAACGCTGGTGAAAGTAAAAGA
TGCTGAAGATCAGTTGGGTGCACGAGTGGGTTACATCGAACTGGATCTCAACAGCGGTAAGATCCTTGAGAGTTTTCGCC
CCGAAGAACGTTTTCCAATGATGAGCACTTTTAAAGTTCTGCTATGTGGCGCGGTATTATCCCGTGTTGACGCCGGGCAA
GAGCAACTCGGTCGCCGCATACACTATTCTCAGAATGACTTGGTTGAGTACTCACCAGTCACAGAAAAGCATCTTACGGA
TGGCATGACAGTAAGAGAATTATGCAGTGCTGCCATAACCATGAGTGATAACACTGCGGCCAACTTACTTCTGACAACGA
TCGGAGGACCGAAGGAGCTAACCGCTTTTTTGCACAACATGGGGGATCATGTAACTCGCCTTGATCGTTGGGAACCGGAG
CTGAATGAAGCCATACCAAACGACGAGCGTGACACCACGATGCCTGCAGCAATGGCAACAACGTTGCGCAAACTATTAAC
TGGCGAACTACTTACTCTAGCTTCCCGGCAACAATTAATAGACTGGATGGAGGCGGATAAAGTTGCAGGACCACTTCTGC
GCTCGGCCCTTCCGGCTGGCTGGTTTATTGCTGATAAATCTGGAGCCGGTGAGCGTGGGTCTCGCGGTATCATTGCAGCA
CTGGGGCCAGATGGTAAGCCCTCCCGTATCGTAGTTATCTACACGACGGGGAGTCAGGCAACTATGGATGAACGAAATAG
ACAGATCGCTGAGATAGGTGCCTCACTGATTAAGCATTGGTAACTGTCAGACCAAGTTTACTCATATATACTTTAGATTG
ATTTAAAACTTCATTTTTAATTTAAAAGGATCTAGGTGAAGATCCTTTTTGATAATCTCATGACCAAAATCCCTTAACGT
GAGTTTTCGTTCCACTGAGCGTCAGACCCCGTAGAAAAGATCAAAGGATCTTCTTGAGATCCTTTTTTTCTGCGCGTAAT
CTGCTGCTTGCAAACAAAAAAACCACCGCTACCAGCGGTGGTTTGTTTGCCGGATCAAGAGCTACCAACTCTTTTTCCGA
AGGTAACTGGCTTCAGCAGAGCGCAGATACCAAATACTGTCCTTCTAGTGTAGCCGTAGTTAGGCCACCACTTCAAGAAC
TCTGTAGCACCGCCTACATACCTCGCTCTGCTAATCCTGTTACCAGTGGCTGCTGCCAGTGGCGATAAGTCGTGTCTTAC
CGGGTTGGACTCAAGACGATAGTTACCGGATAAGGCGCAGCGGTCGGGCTGAACGGGGGGTTCGTGCACACAGCCCAGCT
TGGAGCGAACGACCTACACCGAACTGAGATACCTACAGCGTGAGCTATGAGAAAGCGCCACGCTTCCCGAAGGGAGAAAG
GCGGACAGGTATCCGGTAAGCGGCAGGGTCGGAACAGGAGAGCGCACGAGGGAGCTTCCAGGGGGAAACGCCTGGTATCT
TTATAGTCCTGTCGGGTTTCGCCACCTCTGACTTGAGCGTCGATTTTTGTGATGCTCGTCAGGGGGGCGGAGCCTATGGA
AAAACGCCAGCAACGCGGCCCGACCTCGAGCTGGATACTTCCCGTCCGCCAGGGGGACATGCCGGCGATGCTGAAGGTCG
CGCGCATTCCCGATGAAGAGGCCGGTTACCGCCTGTTTGAGGATATAGTAATCTTTCTAAATAGCTTTGGATTGGAGGAG
TATGGCCACTAATACTAAGTTCAGCTAATAAAAAAATTTGCTAAAGAACTCCAGCTGGATTTCACTGATGAGAATATCGT
CGGAGATAAATATAATAATTCCACGGACTATAGACTATACTAGTATACTCCGTCTACTGTACGATACACTTCCGCTCAGG
TCCTTGTCCTTTAACGAGGATTGTTACGTACGCTAATGGCGTCAAAACAAAGACTCTAGACCTAGGCCTTAAGATCTGAT
CATATGCATCCGCGGGCCCGGGTTAACGCGTAATCCATGGATCAAGAGACAGGATGAGGATCGTTTCGCATGATTGAACA
AGATGGATTGCACGCAGGTTCTCCGGTGCCCTGAATGAACTGCAGAAAGAGCTGGTAGTTGGCGCACTGTTCGAAGAACT
GCCGATGTCCAGTAAGATTCTTACTATGCTGGTTGAACCGGATGCTGGTAAAGCTACTTGGGTTGCTGCTTCTACTTATG
GTACCGATACAACTACTGGTGAGGAAGTTAAAGGAGCTCTTAAAGAAATCCACTTCAGTAGGTGGCCCGGCTCCATGCAC
CGCGACGCAACGCGGGGAGGCAGACAAGGTATAGGGCGGCGCCTACAATCCATGCCAACCCGTTCCATGTGCTCGCCGAG
GCGGCATAAATCGCCGTGACGATCAGCGGTCCAATGATCGAAGTTAGGCTGGTAAGAGCCGCGAGCGATCCTTGAAGCTG
TCCCTGATGGTCGTCATCTACCTGCCTGGACAGCATGGCCTGCAACGCGGGCATCCCGATGCCGCCGGAAGCGAGAAGAA
TCATAATGGGGAAGGCCATCCAGCCTCGCGTCGCGACTAAGAAAATGCCGTCAAATCCGCTCGCCATGACTTCACTAACG
ATGCCTTTGAAAATCTTCAAGTTCTTTTCTACTAATTCAAGGCGTGTCTCACCAGGTTTTTGGTTTGCTCCGGCGCAAAT
GCAGACAATATCAGCATCCTTGCAGGGTATGTTTCTCTTTGATGTCTTTTTGTTTGTGAAGTATTTCACATTTATATTGT
GCAACACTTCACAAACTTTTGCAAGAGAAAAGTTTTGTCTGATTTATGAACAAAAAAGAAACCATCATTGATGGTTTCTT
TCGGTAAGTCCCGTCTAGCCTTGCCCTCAATGGGGAAGAGAACCGCTTAAGCCCGAGTCATTATATAAACCATTTAGCAC
GTAATCAAAGCCAGGCTGATTCTGACCGGGCACTTGGGCGCTGCCATTATTAAAAATCACTTTTGCGTTGGTTGTATCCG
TGTCCGCAGGCAGCGTCAGCGTGTAAATTCCGTCTGCATTTTTAGTCATTGGTTTTCCAGGCCAAGATCCGGTCAATTCA
ATTACTCGGCTCCCATCATGTTTATAGATATAAGCATTTACCTGGCTCCAATGATTCGGATTTTGATAGCCGATGGTTTT
GGCCGACGCTGGATCTCTTTTAACAAAACTGTATTTCTCGGTCCTCGTTACACCATCACTGTTCGTTCCTTTTAACATGA
TGGTGTATGTTTTGCCAAATGGATCTCCTTTTCCGATTGTGAATTGATCTCCATCCTTAAACGCCGTCTCTGGTCCATTA
TTGATTTGATAAACGGCTTTTGTTGTATTCGCATCTGCACGCAAGGTAATCGTCAGTTGATCATTGAAAGAATGTGTTAC
ACCTGTTTTGTAATTCTCAAGGAAAACATGAGGCGCTTTTGCAATATCATCAGGATAAAGCACAGCTACAGACCTGGCAT
TGATCGTGCCTGTCAGTTTACCATCGTTCACTTGAAATGAACCCGCTCCAGCTTTATTGTCATACCTGCCATCAGGCAAT
TTTGTTGCCGTATTGATAGAGACAGAGGATGAACCTGCATTTGCCAGCACAACGCCATGTGAGCCGCGCTGATTCATAAA
TATCTGGTTGTTTCCATTCGGGTTCGAGAGTTCCTCAGGCTGTCCAGCCATCACATTGTGAAATCTATTGACCGCAGTGA
TAGCCTGATCTTCAAATAAAGCACTCCCGCGATCGCCTATTTGGCTTTTCCCCGGGAACCTCACACCATTTCCGCCTCCC
TCAGGTCTGGAAAAGAAAAGAGGCGTACTGCCTGAACGAGAAGCTATCACCGCCCAGCCTAAACGGATATCATCATCGCT
CATCCATGTCGACGCTCTCCCTTATGCGACTCCTGCATTAGGAAGCAGCCCAGTAGTAGGTTGAGGCCGTTGAGCACCGC
CGCCGCAAGGAATGGTGCATGCAAGGAGATGGCGCCCAACAGTCCCCCGGCCACGGGGCCTGCCACCATACCCACGCCGA
AACAAGCGCTCATGAGCCCGAAGTGGCGAGCCCGATCTTCCCCATCGGTGATGTCGGCGATATAGGCGCCAGCAACCGCA
CCTGTGGCGCCGGTGATGCCGGCCACGATGCGTCCGGCGTAGAGGATCTGGAGCTGTAATATAAAAACCTTCTTCAACTA
ACGGGGCAGGTTAGTGACATTAGAAAACCGACTGTAAAAAGTACAGTCGGCATTATCTCATATTATAAAAGCCAGTCATT
AGGCCTATCTGACAATTCCTGAATAGAGTTCATAAACAATCCTGCATGATAACCATCACAAACAGAATGATGTACCTGTA
AAGATAGCGGTAAATATATTGAATTACCTTTATTAATGAATTTTCCTGCTGTAATAATGGGTAGAAGGTAATTACTATTA
TTATTGATATTTAAGTTAAACCCAGTAAATGAAGTCCATGGAATAATAGAAAGAGAAAAAGCATTTTCAGGTATAGGTGT
TTTGGGAAACAATTTCCCCGAACCATTATATTTCTCTACATCAGAAAGGTATAAATCATAAAACTCTTTGAAGTCATTCT
TTACAGGAGTCCAAATACCAGAGAATGTTTTAGATACACCATCAAAAATTGTATAAAGTGGCTCTAACTTATCCCAATAA
CCTAACTCTCCGTCGCTATTGTAACCAGTTCTAAAAGCTGTATTTGAGTTTATCACCCTTGTCACTAAGAAAATAAATGC
AGGGTAAAATTTATATCCTTCTTGTTTTATGTTTCGGTATAAAACACTAATATCAATTTCTGTGGTTATACTAAAAGTCG
TTTGTTGGTTCAAATAATGATTAAATATCTCTTTTCTCTTCCAATTGTCTAAATCAATTTTATTAAAGTTCATTTGATAT
GCCTCCTAAATTTTTATCTAAAGTGAATTTAGGAGGCTTACTTGTCTGCTTTCTTCATTAGAATCAATCCTTTTTTAAAA
GTCAATATTACTGTAACATAAATATATATTTTAAAAATATCCCACTTTATCCAATTTTCGTTTGTTGAACTAATGGGTGC
TTTAGTTGAAGAATAAAAGACCACATTAAAAAATGTGGTCTTTTGTGTTTTTTTAAAGGATTTGAGCGTAGCGAAAAATC
CTTTTCTTTCTTATCTTGATAATAAGGGTAACTATTGCCGATGATAAG

 

Caution:
Product is for research use only!

 

No customer comments for the moment.

Add A Comment

Related Products

Cart  

No products

Total $0.00

Prices don't include postage.

Cart