pDIRECT_23C

$162.00

  • Model: PVT17729
  • 50 Units in Stock
Ask a question


Add to Cart:

pDIRECT_23C

 

Product Name: pDIRECT_23C
Cat No.: PVT17729
Alternative Name: pDIRECT_23C,pDIRECT_23C vector,pDIRECT_23C plasmid,pDIRECT_23C map,pDIRECT_23C sequence
Plasmid form: Freeze-dried powder
Storage Condition: -20 Centigrade
Bulk order Please contact us: sales@lifescience-market.com
Promoter: inquiry
Bacterial Resistance(s): Kan
Screening: inquiry
Growth Strain(s): DB3.1
Culture Medium: LB
Temperature: 37 Centigrade
Vector Size: 15,744bp

 

pDIRECT_23C Sequence

GTAGGCGGTGCTACAGAGTTCTTGAAGTGGTGGCCTAACTACGGCTACACTAGAAGGACAGTATTTGGTATCTGCGCTCT
GCTGAAGCCAGTTACCTTCGGAAAAAGAGTTGGTAGCTCTTGATCCGGCAAACAAACCACCGCTGGTAGCGGTGGTTTTT
TTGTTTGCAAGCAGCAGATTACGCGCAGAAAAAAAGGATCTCAAGAAGATCCTTTGATCTTTTCTACGGGGTCTGACGCT
CAGTGGAACGAAAACTCACGTTAAGGGATTTTGGTCATGCATTCTAGGTACTAAAACAATTCATCCAGTAAAATATAATA
TTTTATTTTCTCCCAATCAGGCTTGATCCCCAGTAAGTCAAAAAATAGCTCGACATACTGTTCTTCCCCGATATCCTCCC
TGATCGACCGGACGCAGAAGGCAATGTCATACCACTTGTCCGCCCTGCCGCTTCTCCCAAGATCAATAAAGCCACTTACT
TTGCCATCTTTCACAAAGATGTTGCTGTCTCCCAGGTCGCCGTGGGAAAAGACAAGTTCCTCTTCGGGCTTTTCCGTCTT
TAAAAAATCATACAGCTCGCGCGGATCTTTAAATGGAGTGTCTTCTTCCCAGTTTTCGCAATCCACATCGGCCAGATCGT
TATTCAGTAAGTAATCCAATTCGGCTAAGCGGCTGTCTAAGCTATTCGTATAGGGACAATCCGATATGTCGATGGAGTGA
AAGAGCCTGATGCACTCCGCATACAGCTCGATAATCTTTTCAGGGCTTTGTTCATCTTCATACTCTTCCGAGCAAAGGAC
GCCATCGGCCTCACTCATGAGCAGATTGCTCCAGCCATCATGCCGTTCAAAGTGCAGGACCTTTGGAACAGGCAGCTTTC
CTTCCAGCCATAGCATCATGTCCTTTTCCCGTTCCACATCATAGGTGGTCCCTTTATACCGGCTGTCCGTCATTTTTAAA
TATAGGTTTTCATTTTCTCCCACCAGCTTATATACCTTAGCAGGAGACATTCCTTCCGTATCTTTTACGCAGCGGTATTT
TTCGATCAGTTTTTTCAATTCCGGTGATATTCTCATTTTAGCCATTTATTATTTCCTTCCTCTTTTCTACAGTATTTAAA
GATACCCCAAGAAGCTAATTATAACAAGACGAACTCCAATTCACTGTTCCTTGCATTCTAAAACCTTAAATACCAGAAAA
CAGCTTTTTCAAAGTTGTTTTCAAAGTTGGCGTATAACATAGTATCGACGGAGCCGATTTTGAAACCGCGGTGATCACAG
GCAGCAACGCTCTGTCATCGTTACAATCAACATGCTACCCTCCGCGAGATCATCCGTGTTTCAAACCCGGCAGCTTAGTT
GCCGTTCTTCCGAATAGCATCGGTAACATGAGCAAAGTCTGCCGCCTTACAACGGCTCTCCCGCTGACGCCGTCCCGGAC
TGATGGGCTGCCTGTATCGAGTGGTGATTTTGTGCCGAGCTGCCGGTCGGGGAGCTGTTGGCTGGCTGGTGGCAGGATAT
ATTGTGGTGTAAACAAATTGACGCTTAGACAACTTAATAACACATTGCGGACGTTTTTAATGTACTGAATTAACGCCGAA
TTAATTCGGGGGATCTGGATTTTAGTACTGGATTTTGGTTTTAGGAATTAGAAATTTTATTGATAGAAGTATTTTACAAA
TACAAATACATACTAAGGGTTTCTTATATGCTCAACACATGAGCGAAACCCTATAGGAACCCTAATTCCCTTATCTGGGA
ACTACTCACACATTATTATGGAGAAACTCGAGTCAAATCTCGGTGACGGGCAGGACCGGACGGGGCGGTACCGGCAGGCT
GAAGTCCAGCTGCCAGAAACCCACGTCATGCCAGTTCCCGTGCTTGAAGCCGGCCGCCCGCAGCATGCCGCGGGGGGCAT
ATCCGAGCGCCTCGTGCATGCGCACGCTCGGGTCGTTGGGCAGCCCGATGACAGCGACCACGCTCTTGAAGCCCTGTGCC
TCCAGGGACTTCAGCAGATGGGTGTAGAGCGTGGAGCCCAGTCCCGTCCGCTGGTGGCGGGGGCTGACGTACACGGTCGA
CTCGGCCGTCCAGTCGTAGGCGTTGCGTGCCTTCCAGGGGCCCGCGTAGGCGATGCCGGCGACCTCGCCGTCCACCTCGG
CGACGAGCCAGGGATAGCGCTCCCGCAGACGGACGAGGTCGTCCGTCCACTCCTGCGGTTCCTGCGGCTCGGTACGGAAG
TTGACCGTGCTTGTCTCGATGTAGTGGTTGACGATGGTGCAGACCGCCGGCATGTCCGCCTCGGTGGCACGGCGGATGTC
GGCCGGGCGTCGTTCTGGGCTCATGGTAGACTCGAGAGAGATAGATTTGTAGAGAGAGACTGGTGATTTCAGCGTGTCCT
CTCCAAATGAAATGAACTTCCTTATATAGAGGAAGGGTCTTGCGAAGGATAGTGGGATTGTGCGTCATCCCTTACGTCAG
TGGAGATATCACATCAATCCACTTGCTTTGAAGACGTGGTTGGAACGTCTTCTTTTTCCACGATGCTCCTCGTGGGTGGG
GGTCCATCTTTGGGACCACTGTCGGCAGAGGCATCTTGAACGATAGCCTTTCCTTTATCGCAATGATGGCATTTGTAGGT
GCCACCTTCCTTTTCTACTGTCCTTTTGATGAAGTGACAGATAGCTGGGCAATGGAATCCGAGGAGGTTTCCCGATATTA
CCCTTTGTTGAAAAGTCTCAATAGCCCTTTGGTCTTCTGAGACTGTATCTTTGATATTCTTGGAGTAGACGAGAGTGTCG
TGCTCCACCATGTTCACATCAATCCACTTGCTTTGAAGACGTGGTTGGAACGTCTTCTTTTTCCACGATGCTCCTCGTGG
GTGGGGGTCCATCTTTGGGACCACTGTCGGCAGAGGCATCTTGAACGATAGCCTTTCCTTTATCGCAATGATGGCATTTG
TAGGTGCCACCTTCCTTTTCTACTGTCCTTTTGATGAAGTGACAGATAGCTGGGCAATGGAATCCGAGGAGGTTTCCCGA
TATTACCCTTTGTTGAAAAGTCTCAATAGCCCTTTGGTCTTCTGAGACTGTATCTTTGATATTCTTGGAGTAGACGAGAG
TGTCGTGCTCCACCATGTTGGCAAGCTGCTCTAGCCAATACGCAAACCGCCTCTCCCCGCGCGTTGGCCGATTCATTAAT
GCAGCTGGCACGACAGGTTTCCCGACTGGAAAGCGGGCAGTGAGCGCAACGCAATTAATGTGAGTTAGCTCACTCATTAG
GCACCCCAGGCTTTACACTTTATGCTTCCGGCTCGTATGTTGTGTGGAATTGTGAGCGGATAACAATTTCACACAGGAAA
CAGCTATGACATGATTACGAATTCGAGCTCGGTACCCGGGGATCGGCGCGCCAGATTTGCCTTTTCAATTTCAGAAAGAA
TGCTAACCCACAGATGGTTAGAGAGGCTTACGCAGCAGGTATCATCAAGACGATCTACCCGAGCAATAATCTCCAGGAAA
TCAAATACCTTCCCAAGAAGGTTAAAGATGCAGTCAAAAGATTCAGGACTAACTGCATCAAGAACACAGAGAAAGATATA
TTTCTCAAGATCAGAAGTACTATTCCAGTATGGACGATTCAAGGCTTGCTTCACAAACCAAGGCAAGTAATAGAGATTGG
AGTCTCTAAAAAGGTAGTTCCCACTGAATCAAAGGCCATGGAGTCAAAGATTCAAATAGAGGACCTAACAGAACTCGCCG
TAAAGACTGGCGAACAGTTCATACAGAGTCTCTTACGACTCAATGACAAGAAGAAAATCTTCGTCAACATGGTGGAGCAC
GACACACTTGTCTACTCCAAAAATATCAAAGATACAGTCTCAGAAGACCAAAGGGCAATTGAGACTTTTCAACAAAGGGT
AATATCCGGAAACCTCCTCGGATTCCATTGCCCAGCTATCTGTCACTTTATTGTGAAGATAGTGGAAAAGGAAGGTGGCT
CCTACAAATGCCATCATTGCGATAAAGGAAAGGCCATCGTTGAAGATGCCTCTGCCGACAGTGGTCCCAAAGATGGACCC
CCACCCACGAGGAGCATCGTGGAAAAAGAAGACGTTCCAACCACGTCTTCAAAGCAAGTGGATTGATGTGATATCTCCAC
TGACGTAAGGGATGACGCACAATCCCACTATCCTTCGCAAGACCCTTCCTCTATATAAGGAAGTTCATTTCATTTGGAGA
GAACACGGGGGACTCCTGCAGGAAAAATGGATCATTATCTTGATATTAGACTTAGACCTGATCCAGAATTTCCACCAGCT
CAACTTATGTCTGTTCTTTTTGGAAAACTTCATCAAGCTCTTGTTGCTCAAGGAGGAGATAGAATTGGAGTTTCTTTTCC
TGATCTTGATGAATCAAGATCAAGACTTGGAGAAAGACTTAGAATTCATGCTTCTGCTGATGATCTTAGAGCTTTGCTTG
CTAGACCTTGGCTTGAAGGACTTAGAGATCATCTTCAATTTGGAGAACCAGCTGTTGTTCCACATCCAACTCCTTATAGA
CAAGTTTCAAGAGTTCAAGCTAAATCTAATCCAGAAAGACTTAGAAGAAGACTTATGAGAAGACATGATCTTTCTGAAGA
AGAAGCTAGAAAAAGAATTCCTGATACTGTTGCTAGAGCTTTGGATTTGCCTTTTGTTACACTTAGATCACAATCTACTG
GACAACATTTTAGACTTTTTATTAGACATGGACCACTTCAAGTTACTGCTGAAGAAGGAGGATTTACTTGTTATGGACTT
TCTAAGGGAGGTTTTGTTCCTTGGTTTGGATCTGGAGCTACTAATTTTTCTCTTCTTAAGCAAGCTGGAGATGTTGAAGA
AAATCCTGGACCCATGGATAAGAAGTACTCTATCGGACTCGATATCGGAACTAACTCTGTGGGATGGGCTGTGATCACCG
ATGAGTACAAGGTGCCATCTAAGAAGTTCAAGGTTCTCGGAAACACCGATAGGCACTCTATCAAGAAAAACCTTATCGGT
GCTCTCCTCTTCGATTCTGGTGAAACTGCTGAGGCTACCAGACTCAAGAGAACCGCTAGAAGAAGGTACACCAGAAGAAA
GAACAGGATCTGCTACCTCCAAGAGATCTTCTCTAACGAGATGGCTAAAGTGGATGATTCATTCTTCCACAGGCTCGAAG
AGTCATTCCTCGTGGAAGAAGATAAGAAGCACGAGAGGCACCCTATCTTCGGAAACATCGTTGATGAGGTGGCATACCAC
GAGAAGTACCCTACTATCTACCACCTCAGAAAGAAGCTCGTTGATTCTACTGATAAGGCTGATCTCAGGCTCATCTACCT
CGCTCTCGCTCACATGATCAAGTTCAGAGGACACTTCCTCATCGAGGGTGATCTCAACCCTGATAACTCTGATGTGGATA
AGTTGTTCATCCAGCTCGTGCAGACCTACAACCAGCTTTTCGAAGAGAACCCTATCAACGCTTCAGGTGTGGATGCTAAG
GCTATCCTCTCTGCTAGGCTCTCTAAGTCAAGAAGGCTTGAGAACCTCATTGCTCAGCTCCCTGGTGAGAAGAAGAACGG
ACTTTTCGGAAACTTGATCGCTCTCTCTCTCGGACTCACCCCTAACTTCAAGTCTAACTTCGATCTCGCTGAGGATGCAA
AGCTCCAGCTCTCAAAGGATACCTACGATGATGATCTCGATAACCTCCTCGCTCAGATCGGAGATCAGTACGCTGATTTG
TTCCTCGCTGCTAAGAACCTCTCTGATGCTATCCTCCTCAGTGATATCCTCAGAGTGAACACCGAGATCACCAAGGCTCC
ACTCTCAGCTTCTATGATCAAGAGATACGATGAGCACCACCAGGATCTCACACTTCTCAAGGCTCTTGTTAGACAGCAGC
TCCCAGAGAAGTACAAAGAGATTTTCTTCGATCAGTCTAAGAACGGATACGCTGGTTACATCGATGGTGGTGCATCTCAA
GAAGAGTTCTACAAGTTCATCAAGCCTATCCTCGAGAAGATGGATGGAACCGAGGAACTCCTCGTGAAGCTCAATAGAGA
GGATCTTCTCAGAAAGCAGAGGACCTTCGATAACGGATCTATCCCTCATCAGATCCACCTCGGAGAGTTGCACGCTATCC
TTAGAAGGCAAGAGGATTTCTACCCATTCCTCAAGGATAACAGGGAAAAGATTGAGAAGATTCTCACCTTCAGAATCCCT
TACTACGTGGGACCTCTCGCTAGAGGAAACTCAAGATTCGCTTGGATGACCAGAAAGTCTGAGGAAACCATCACCCCTTG
GAACTTCGAAGAGGTGGTGGATAAGGGTGCTAGTGCTCAGTCTTTCATCGAGAGGATGACCAACTTCGATAAGAACCTTC
CAAACGAGAAGGTGCTCCCTAAGCACTCTTTGCTCTACGAGTACTTCACCGTGTACAACGAGTTGACCAAGGTTAAGTAC
GTGACCGAGGGAATGAGGAAGCCTGCTTTTTTGTCAGGTGAGCAAAAGAAGGCTATCGTTGATCTCTTGTTCAAGACCAA
CAGAAAGGTGACCGTGAAGCAGCTCAAAGAGGATTACTTCAAGAAAATCGAGTGCTTCGATTCAGTTGAGATTTCTGGTG
TTGAGGATAGGTTCAACGCATCTCTCGGAACCTACCACGATCTCCTCAAGATCATTAAGGATAAGGATTTCTTGGATAAC
GAGGAAAACGAGGATATCTTGGAGGATATCGTTCTTACCCTCACCCTCTTTGAAGATAGAGAGATGATTGAAGAAAGGCT
CAAGACCTACGCTCATCTCTTCGATGATAAGGTGATGAAGCAGTTGAAGAGAAGAAGATACACTGGTTGGGGAAGGCTCT
CAAGAAAGCTCATTAACGGAATCAGGGATAAGCAGTCTGGAAAGACAATCCTTGATTTCCTCAAGTCTGATGGATTCGCT
AACAGAAACTTCATGCAGCTCATCCACGATGATTCTCTCACCTTTAAAGAGGATATCCAGAAGGCTCAGGTTTCAGGACA
GGGTGATAGTCTCCATGAGCATATCGCTAACCTCGCTGGATCTCCTGCAATCAAGAAGGGAATCCTCCAGACTGTGAAGG
TTGTGGATGAGTTGGTGAAGGTGATGGGAAGGCATAAGCCTGAGAACATCGTGATCGAAATGGCTAGAGAGAACCAGACC
ACTCAGAAGGGACAGAAGAACTCTAGGGAAAGGATGAAGAGGATCGAGGAAGGTATCAAAGAGCTTGGATCTCAGATCCT
CAAAGAGCACCCTGTTGAGAACACTCAGCTCCAGAATGAGAAGCTCTACCTCTACTACCTCCAGAACGGAAGGGATATGT
ATGTGGATCAAGAGTTGGATATCAACAGGCTCTCTGATTACGATGTTGATCATATCGTGCCACAGTCATTCTTGAAGGAT
GATTCTATCGATAACAAGGTGCTCACCAGGTCTGATAAGAACAGGGGTAAGAGTGATAACGTGCCAAGTGAAGAGGTTGT
GAAGAAAATGAAGAACTATTGGAGGCAGCTCCTCAACGCTAAGCTCATCACTCAGAGAAAGTTCGATAACTTGACTAAGG
CTGAGAGGGGAGGACTCTCTGAATTGGATAAGGCAGGATTCATCAAGAGGCAGCTTGTGGAAACCAGGCAGATCACTAAG
CACGTTGCACAGATCCTCGATTCTAGGATGAACACCAAGTACGATGAGAACGATAAGTTGATCAGGGAAGTGAAGGTTAT
CACCCTCAAGTCAAAGCTCGTGTCTGATTTCAGAAAGGATTTCCAATTCTACAAGGTGAGGGAAATCAACAACTACCACC
ACGCTCACGATGCTTACCTTAACGCTGTTGTTGGAACCGCTCTCATCAAGAAGTATCCTAAGCTCGAGTCAGAGTTCGTG
TACGGTGATTACAAGGTGTACGATGTGAGGAAGATGATCGCTAAGTCTGAGCAAGAGATCGGAAAGGCTACCGCTAAGTA
TTTCTTCTACTCTAACATCATGAATTTCTTCAAGACCGAGATTACCCTCGCTAACGGTGAGATCAGAAAGAGGCCACTCA
TCGAGACAAACGGTGAAACAGGTGAGATCGTGTGGGATAAGGGAAGGGATTTCGCTACCGTTAGAAAGGTGCTCTCTATG
CCACAGGTGAACATCGTTAAGAAAACCGAGGTGCAGACCGGTGGATTCTCTAAAGAGTCTATCCTCCCTAAGAGGAACTC
TGATAAGCTCATTGCTAGGAAGAAGGATTGGGACCCTAAGAAATACGGTGGTTTCGATTCTCCTACCGTGGCTTACTCTG
TTCTCGTTGTGGCTAAGGTTGAGAAGGGAAAGAGTAAGAAGCTCAAGTCTGTTAAGGAACTTCTCGGAATCACTATCATG
GAAAGGTCATCTTTCGAGAAGAACCCAATCGATTTCCTCGAGGCTAAGGGATACAAAGAGGTTAAGAAGGATCTCATCAT
CAAGCTCCCAAAGTACTCACTCTTCGAACTCGAGAACGGTAGAAAGAGGATGCTCGCTTCTGCTGGTGAGCTTCAAAAGG
GAAACGAGCTTGCTCTCCCATCTAAGTACGTTAACTTTCTTTACCTCGCTTCTCACTACGAGAAGTTGAAGGGATCTCCA
GAAGATAACGAGCAGAAGCAACTTTTCGTTGAGCAGCACAAGCACTACTTGGATGAGATCATCGAGCAGATCTCTGAGTT
CTCTAAAAGGGTGATCCTCGCTGATGCAAACCTCGATAAGGTGTTGTCTGCTTACAACAAGCACAGAGATAAGCCTATCA
GGGAACAGGCAGAGAACATCATCCATCTCTTCACCCTTACCAACCTCGGTGCTCCTGCTGCTTTCAAGTACTTCGATACA
ACCATCGATAGGAAGAGATACACCTCTACCAAAGAAGTGCTCGATGCTACCCTCATCCATCAGTCTATCACTGGACTCTA
CGAGACTAGGATCGATCTCTCACAGCTCGGTGGTGATTCAAGGGCTGATCCTAAGAAGAAGAGGAAGGTTTGACTCGAGA
TATGAAGATGAAGATGAAATATTTGGTGTGTCAAATAAAAAGCTTGTGTGCTTAAGTTTGTGTTTTTTTCTTGGCTTGTT
GTGTTATGAATTTGTGGCTTTTTCTAATATTAAATGAATGTAAGATCACATTATAATGAATAAACAAATGTTTCTATAAT
CCATTGTGAATGTTTTGTTGGATCTCTTCTGCAGCATATAACTACTGTATGTGCTATGGTATGGACTATGGAATATGATT
AAAGATAAGGAGCTCCGGTGACGGACGGCGCGCCGAAGAGCTGGCAGACATACTGTCCCACAAATGAAGATGGAATCTGT
AAAAGAAAACGCGTGAAATAATGCGTCTGACAAAGGTTAGGTCGGCTGCCTTTAATCAATACCAAAGTGGTCCCTACCAC
GATGGAAAAACTGTGCAGTCGGTTTGGCTTTTTCTGACGAACAAATAAGATTCGTGGCCGACAGGTGGGGGTCCACCATG
TGAAGGCATCTTCAGACTCCAATAATGGAGCAATGACGTAAGGGCTTACGAAATAAGTAAGGGTAGTTTGGGAAATGTCC
ACTCACCCGTCAGTCTATAAATACTTAGCCCCTCCCTCATTGTTAAGGGAGCAAAATCTCAGAGAGATAGTCCTAGAGAG
AGAAAGAGAGCAAGTAGCCTAGAAGTAGTCAAGGCGGCGAAGTATTCAGGCACGTGGCCAGGAAGAAGAAAAGCCAAGAC
GACGAAAACAGGTAAGAGCTAAGCTTCCTGCAGGTTCACTGCCGTATAGGCAGGTTTTAGAGCTAGAAATAGCAAGTTAA
AATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCGTTCACTGCCGTATAGGCAGAAGCCAGATAA
CAGTATGCGTATTTGCGCGCTGATTTTTGCGGTATAAGAATATATACTGATATGTATACCCGAAGTATGTCAAAAGGAGG
TATGCTATGAAGCAGCGTATTACAGTGACAGTTGACAGCGACAGCTATCAGTTGCTCAAGGCATATATGATGTCAATATC
TCCGGTCTGGTAAGCACAACCATGCAGAATGAAGCCCGTCGTCTGCGTGCCGAACGCTGGAAAGCGGAAAATCAGGAAGG
GATGGCTGAGGTCGCCCGGTTTATTGAAATGAACGGCTCTTTTGCTGACGAGAACAGGGGCTGGTGAAATGCAGTTTAAG
GTTTACACCTATAAAAGAGAGAGCCGTTATCGTCTGTTTGTGGATGTACAGAGTGATATTATTGACACGCCCGGGCGACG
GATGGTGATCCCCCTGGCCAGTGCACGTCTGCTGTCAGATAAAGTCTCCCGTGAACTTTACCCGGTGGTGCATATCGGGG
ATGAAAGCTGGCGCATGATGACCACCGATATGGCCAGTGTGCCGGTTTCCGTTATCGGGGAAGAAGTGGCTGATCTCAGC
CACCGCGAAAATGACATCAAAAACGCCATTAACCTGATGTTCTGGGGAATATAAGCTCTTCAGTCGATCGACAAGCTCGA
GTTTCTCCATAATAATGTGTGAGTAGTTCCCAGATAAGGGAATTAGGGTTCCTATAGGGTTTCGCTCATGTGTTGAGCAT
ATAAGAAACCCTTAGTATGTATTTGTATTTGTAAAATACTTCTATCAATAAAATTTCTAATTCCTAAAACCAAAATCCAG
TACTAAAATCCAGATCCCCCGAATTACCGGTGGCACTGGCCGTCGTTTTACAACGTCGTGACTGGGAAAACCCTGGCGTT
ACCCAACTTAATCGCCTTGCAGCACATCCCCCTTTCGCCAGCTGGCGTAATAGCGAAGAGGCCCGCACCGATCGCCCTTC
CCAACAGTTGCGCAGCCTGAATGGCGAATGCTAGAGCAGCTTGAGCTTGGATCAGATTGTCGTTTCCCGCCTTCAGTTTA
AACTATCAGTGTTTGACAGGATATATTGGCGGGTAAACCTAAGAGAAAAGAGCGTTTATTAGAATAATCGGATATTTAAA
AGGGCGTGAAAAGGTTTATCCGTTCGTCCATTTGTATGTGCATGCCAACCACAGGGTTCCCCTCGGGATCAAAGTACTTT
GATCCAACCCCTCCGCTGCTATAGTGCAGTCGGCTTCTGACGTTCAGTGCAGCCGTCTTCTGAAAACGACATGTCGCACA
AGTCCTAAGTTACGCGACAGGCTGCCGCCCTGCCCTTTTCCTGGCGTTTTCTTGTCGCGTGTTTTAGTCGCATAAAGTAG
AATACTTGCGACTAGAACCGGAGACATTACGCCATGAACAAGAGCGCCGCCGCTGGCCTGCTGGGCTATGCCCGCGTCAG
CACCGACGACCAGGACTTGACCAACCAACGGGCCGAACTGCACGCGGCCGGCTGCACCAAGCTGTTTTCCGAGAAGATCA
CCGGCACCAGGCGCGACCGCCCGGAGCTGGCCAGGATGCTTGACCACCTACGCCCTGGCGACGTTGTGACAGTGACCAGG
CTAGACCGCCTGGCCCGCAGCACCCGCGACCTACTGGACATTGCCGAGCGCATCCAGGAGGCCGGCGCGGGCCTGCGTAG
CCTGGCAGAGCCGTGGGCCGACACCACCACGCCGGCCGGCCGCATGGTGTTGACCGTGTTCGCCGGCATTGCCGAGTTCG
AGCGTTCCCTAATCATCGACCGCACCCGGAGCGGGCGCGAGGCCGCCAAGGCCCGAGGCGTGAAGTTTGGCCCCCGCCCT
ACCCTCACCCCGGCACAGATCGCGCACGCCCGCGAGCTGATCGACCAGGAAGGCCGCACCGTGAAAGAGGCGGCTGCACT
GCTTGGCGTGCATCGCTCGACCCTGTACCGCGCACTTGAGCGCAGCGAGGAAGTGACGCCCACCGAGGCCAGGCGGCGCG
GTGCCTTCCGTGAGGACGCATTGACCGAGGCCGACGCCCTGGCGGCCGCCGAGAATGAACGCCAAGAGGAACAAGCATGA
AACCGCACCAGGACGGCCAGGACGAACCGTTTTTCATTACCGAAGAGATCGAGGCGGAGATGATCGCGGCCGGGTACGTG
TTCGAGCCGCCCGCGCACGGCTCAACCGTGCGGCTGCATGAAATCCTGGCCGGTTTGTCTGATGCCAAGCTGGCGGCCTG
GCCGGCCAGCTTGGCCGCTGAAGAAACCGAGCGCCGCCGTCTAAAAAGGTGATGTGTATTTGAGTAAAACAGCTTGCGTC
ATGCGGTCGCTGCGTATATGATGCGATGAGTAAATAAACAAATACGCAAGGGGAACGCATGAAGGTTATCGCTGTACTTA
ACCAGAAAGGCGGGTCAGGCAAGACGACCATCGCAACCCATCTAGCCCGCGCCCTGCAACTCGCCGGGGCCGATGTTCTG
TTAGTCGATTCCGATCCCCAGGGCAGTGCCCGCGATTGGGCGGCCGTGCGGGAAGATCAACCGCTAACCGTTGTCGGCAT
CGACCGCCCGACGATTGACCGCGACGTGAAGGCCATCGGCCGGCGCGACTTCGTAGTGATCGACGGAGCGCCCCAGGCGG
CGGACTTGGCTGTGTCCGCGATCAAGGCAGCCGACTTCGTGCTGATTCCGGTGCAGCCAAGCCCTTACGACATATGGGCC
ACCGCCGACCTGGTGGAGCTGGTTAAGCAGCGCATTGAGGTCACGGATGGAAGGCTACAAGCGGCCTTTGTCGTGTCGCG
GGCGATCAAAGGCACGCGCATCGGCGGTGAGGTTGCCGAGGCGCTGGCCGGGTACGAGCTGCCCATTCTTGAGTCCCGTA
TCACGCAGCGCGTGAGCTACCCAGGCACTGCCGCCGCCGGCACAACCGTTCTTGAATCAGAACCCGAGGGCGACGCTGCC
CGCGAGGTCCAGGCGCTGGCCGCTGAAATTAAATCAAAACTCATTTGAGTTAATGAGGTAAAGAGAAAATGAGCAAAAGC
ACAAACACGCTAAGTGCCGGCCGTCCGAGCGCACGCAGCAGCAAGGCTGCAACGTTGGCCAGCCTGGCAGACACGCCAGC
CATGAAGCGGGTCAACTTTCAGTTGCCGGCGGAGGATCACACCAAGCTGAAGATGTACGCGGTACGCCAAGGCAAGACCA
TTACCGAGCTGCTATCTGAATACATCGCGCAGCTACCAGAGTAAATGAGCAAATGAATAAATGAGTAGATGAATTTTAGC
GGCTAAAGGAGGCGGCATGGAAAATCAAGAACAACCAGGCACCGACGCCGTGGAATGCCCCATGTGTGGAGGAACGGGCG
GTTGGCCAGGCGTAAGCGGCTGGGTTGCCTGCCGGCCCTGCAATGGCACTGGAACCCCCAAGCCCGAGGAATCGGCGTGA
GCGGTCGCAAACCATCCGGCCCGGTACAAATCGGCGCGGCGCTGGGTGATGACCTGGTGGAGAAGTTGAAGGCCGCGCAG
GCCGCCCAGCGGCAACGCATCGAGGCAGAAGCACGCCCCGGTGAATCGTGGCAAGCGGCCGCTGATCGAATCCGCAAAGA
ATCCCGGCAACCGCCGGCAGCCGGTGCGCCGTCGATTAGGAAGCCGCCCAAGGGCGACGAGCAACCAGATTTTTTCGTTC
CGATGCTCTATGACGTGGGCACCCGCGATAGTCGCAGCATCATGGACGTGGCCGTTTTCCGTCTGTCGAAGCGTGACCGA
CGAGCTGGCGAGGTGATCCGCTACGAGCTTCCAGACGGGCACGTAGAGGTTTCCGCAGGGCCGGCCGGCATGGCCAGTGT
GTGGGATTACGACCTGGTACTGATGGCGGTTTCCCATCTAACCGAATCCATGAACCGATACCGGGAAGGGAAGGGAGACA
AGCCCGGCCGCGTGTTCCGTCCACACGTTGCGGACGTACTCAAGTTCTGCCGGCGAGCCGATGGCGGAAAGCAGAAAGAC
GACCTGGTAGAAACCTGCATTCGGTTAAACACCACGCACGTTGCCATGCAGCGTACGAAGAAGGCCAAGAACGGCCGCCT
GGTGACGGTATCCGAGGGTGAAGCCTTGATTAGCCGCTACAAGATCGTAAAGAGCGAAACCGGGCGGCCGGAGTACATCG
AGATCGAGCTAGCTGATTGGATGTACCGCGAGATCACAGAAGGCAAGAACCCGGACGTGCTGACGGTTCACCCCGATTAC
TTTTTGATCGATCCCGGCATCGGCCGTTTTCTCTACCGCCTGGCACGCCGCGCCGCAGGCAAGGCAGAAGCCAGATGGTT
GTTCAAGACGATCTACGAACGCAGTGGCAGCGCCGGAGAGTTCAAGAAGTTCTGTTTCACCGTGCGCAAGCTGATCGGGT
CAAATGACCTGCCGGAGTACGATTTGAAGGAGGAGGCGGGGCAGGCTGGCCCGATCCTAGTCATGCGCTACCGCAACCTG
ATCGAGGGCGAAGCATCCGCCGGTTCCTAATGTACGGAGCAGATGCTAGGGCAAATTGCCCTAGCAGGGGAAAAAGGTCG
AAAAGGCCTCTTTCCTGTGGATAGCACGTACATTGGGAACCCAAAGCCGTACATTGGGAACCGGAACCCGTACATTGGGA
ACCCAAAGCCGTACATTGGGAACCGGTCACACATGTAAGTGACTGATATAAAAGAGAAAAAAGGCGATTTTTCCGCCTAA
AACTCTTTAAAACTTATTAAAACTCTTAAAACCCGCCTGGCCTGTGCATAACTGTCTGGCCAGCGCACAGCCCAAGAGCT
GCAAAAAGCGCCTACCCTTCGGTCGCTGCGCTCCCTACGCCCCGCCGCTTCGCGTCGGCCTATCGCGGCCGCTGGCCGCT
CAAAAATGGCTGGCCTACGGCCAGGCAATCTACCAGGGCGCGGACAAGCCGCGCCGTCGCCACTCGACCGCCGGCGCCCA
CATCAAGGCACCCTGCCTCGCGCGTTTCGGTGATGACGGTGAAAACCTCTGACACATGCAGCTCCCGGAAACGGTCACAG
CTTGTCTGTAAGCGGATGCCGGGAGCAGACAAGCCCGTCAGGGCGCGTCAGCGGGTGTTGGCGGGTGTCGGGGCGCAGCC
ATGACCCAGTCACGTAGCGATAGCGGAGTGTATACTGGCTTAACTATGCGGCATCAGAGCAGATTGTACTGAGAGTGCAC
CATATGCGGTGTGAAATACCGCACAGATGCGTAAGGAGAAAATACCGCATCAGGCCCTCTTCCGCTTCCTCGCTCACTGA
CTCGCTGCGCTCGGTCGTTCGGCTGCGGCGAGCGGTATCAGCTCACTCAAAGGCGGTAATACGGTTATCCACAGAATCAG
GGGATAACGCAGGAAAGAACATGTGAGCAAAAGGCCAGCAAAAGGCCAGGAACCGTAAAAAGGCCGCGTTGCTGGCGTTT
TTCCATAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGACGCTCAAGTCAGAGGTGGCGAAACCCGACAGGACTATA
AAGATACCAGGCGTTTCCCCCTGGAAGCTCCCTCGTGCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCG
CCTTTCTCCCTTCGGGAAGCGTGGCGCTTTCTCATAGCTCACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCC
AAGCTGGGCTGTGTGCACGAACCCCCCGTTCAGCCCGACCGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTCCAACCC
GGTAAGACACGACTTATCGCCACTGGCAGCAGCCACTGGTAACAGGATTAGCAGAGCGAGGTAT
//

*Product is for research use only!

No customer comments for the moment.

Add A Comment

Related Products

Cart  

No products

Total $0.00

Prices don't include postage.

Cart